spacer

Target Detailed View


Hit information for ENSMMUT00000027294

Gene Name DNAJC12
Transcript ENSMMUT00000027294
Gene ENSMMUG00000019425
Description DnaJ homolog subfamily C member 12 (J domain-containing protein 1). [Source:Uniprot/SWISSPROT;Acc:Q9UKB3]
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
hsa-miR-374b 20.1227 -19.37 3.563510e-03 3.563510e-03 1.651640e-03 226 247
GUGAAUCGUCCAACAUAAUAUA
:||  ||:|| |||||||||||
TACAGAGTAGATTGTATTATAT
hsa-miR-203 18.8174 -19.3 8.494590e-03 8.458610e-03 8.025170e-03 301 322
gAUCACCAGGAUUUGUAAAGUG
 |||||  ::||||:||||||:
aTAGTGTATTTAAATATTTCAT
hsa-miR-374a 18.7087 -12.87 1.188440e-02 1.181410e-02 1.651640e-03 226 247
GUGAAUAGUCCAACAUAAUAUu
:||  | :|| ||||||||||
TACAGAGTAGATTGTATTATAt
hsa-miR-539 17.9473 -15.63 2.131820e-02 2.109260e-02 9.963290e-03 174 196
UGUGUGGUUCCUA-UUAAAGAGG
| |: | :| ||| |||||||||
AAATTCAGAAGATGAATTTCTCC
hsa-miR-146a 17.9473 -22.21 1.131380e-02 1.131380e-02 2.823910e-04 134 153
uUGGGUACCUUAAGUCAAGAGU
 |:|| | ||| ||||||||||
cATCC-TTGAA-TCAGTTCTCA
hsa-miR-144 17.6956 -16.08 1.663540e-02 1.649780e-02 2.791610e-04 316 334
UCAUGUAGUAGAUAUGACAU
| | ||||| | |||||||:
ATTTCATCAAC-ATACTGTG
hsa-miR-380 17.5122 -15.49 1.946020e-02 1.927210e-02 1.927210e-02 228 248
uUCUACACCUGGUAUAAUGUAU
 ||| || ||:::|||||:||:
cAGA-GTAGATTGTATTATATG
hsa-miR-146b-5p 17.4034 -21.66 1.694730e-02 1.680450e-02 2.823910e-04 133 153
ucggauACCUUAAGUCAAGAGU
      | ||| ||||||||||
ccatccTTGAA-TCAGTTCTCA
hsa-miR-876-5p 17.1859 -14.63 2.359470e-02 2.331850e-02 2.331850e-02 260 281
accacuAAGUGUUUCUUUAGGU
      | | :| |||||||||
taacacTACTTATAGAAATCCA
hsa-miR-369-3p 16.9453 -10.17 3.621600e-02 3.556800e-02 3.560290e-04 227 246
UUUCUAGUUGGUACAUAAUAa
| ||| :|: : ||||||||
ACAGAGTAGAT-TGTATTATa
mml-miR-103 16.8867 -17.88 3.161750e-02 3.112290e-02 4.974100e-05 29 51
aGUAUCGGGACAUGUUACGACGa
 || : |: | | | |||||||
gCAAGACTGTCTTCTATGCTGCc
hsa-miR-548a-5p 16.8596 -10.62 6.904440e-02 6.671480e-02 3.190630e-03 385 406
ccAUUUUGAGCGUUAAUGAAaa
  |:|||: :| ||||||||
aaTGAAATGTGAAATTACTTgt
mml-miR-196 16.6173 -15.42 3.736670e-02 3.667720e-02 3.219110e-03 385 405
gguugUUGUACUUUGAUGGAU
     ||::|||||:|||:|:
aatgaAATGTGAAATTACTTG
hsa-miR-498 16.5619 -16.41 3.351110e-02 3.295580e-02 3.295580e-02 1 17
cuuuUUGCGGGGGACCGAACUUU
    ||: :|:|:  ||||||||
----AATATCTCT--GCTTGAAA
mmu-miR-201 16.5332 -16.92 3.178230e-02 3.128260e-02 1.153610e-02 98 119
uUCUUGUUACGGAAUGACUCAU
 | : | :||  ||:|||||||
cATGTCTGTGAATTGCTGAGTA
hsa-miR-655 16.5332 -11.39 4.913040e-02 4.794300e-02 2.520440e-02 225 245
UUUCUCCAAUUGGUACAUAAUA
| | ||  ||: : ||||||||
ATACAGAGTAGAT-TGTATTAT
hsa-miR-555 16.508 -14.09 2.442990e-02 2.413390e-02 2.413390e-02 357 376
uagUCUCCAAGUCGAAUGGGA
   | | |||:  ||||||||
aaaAAATGTTT-TCTTACCCT
hsa-miR-513-3p 16.4537 -10.9 6.180100e-02 5.993010e-02 4.037640e-04 380 402
GGAAGAGUCUUUCCACUUUAAau
|:| |   |||| ||||||||
CTTACAATGAAATGTGAAATTac
mmu-miR-465a-5p 16.4537 -12.38 7.499180e-02 3.268210e-03 3.268210e-03 149 169
AGUGUAGUCACGGUAAGAUUUAU
|| ||| | |||: ||:|||||:
TCTCAT-AATGCT-TTTTAAATG
hsa-miR-431 16.3987 -16.43 3.238860e-02 3.186970e-02 1.214620e-02 16 36
acgUACUGCCGGACGUUCUGu
   |||| |    |||||||
aaaATGAGGAAGAGCAAGACt
mml-miR-107 16.3454 -16.77 5.091930e-02 4.964460e-02 3.222240e-05 29 51
acUAUCGGGACAUGUUACGACGa
  | : |: | | | |||||||
gcAAGACTGTCTTCTATGCTGCc
mmu-miR-465b-5p 16.3157 -7.04 8.311130e-02 3.268210e-03 3.268210e-03 392 413
gucuagUCGUGGUAAGAUUUAu
      | :||:  |||||||
tgtgaaATTACTTGTCTAAATc
mml-miR-181b 16.1627 -14.06 6.970650e-02 6.970650e-02 7.461400e-04 332 355
uuggguGGCUGUCGUUACUUACAa
      :| |: |::|||:||||
gtgatcTCTATTGTGATGGATGTa
hsa-miR-768-5p 16.1313 -20.26 8.866530e-02 3.705970e-03 3.705970e-03 109 137
UAGUGAGGCAUGA--AAGU-AGGAGGUug
||::||  |||||  || | |||||||
ATTGCTGAGTACTAATTGATTCCTCCAtc
hsa-miR-567 16.0207 -7.92 4.936810e-02 4.816930e-02 3.897510e-03 309 331
cAAGACAGGACCUUCUUGUAUGA
 ||   | :|  |  ||||||||
tTTAAATATTTCATCAACATACT
hsa-miR-433 15.9894 -15.24 4.179680e-02 4.093540e-02 1.675700e-03 327 348
UGUGGCUCCUCGGGUAGUACUA
|:||:| |   :|:||::||||
ATACTGTGATCTCTATTGTGAT
mml-miR-215 15.8521 -16.89 3.310090e-02 3.255910e-02 3.428510e-05 79 100
cagACAGU-UAAGUAUCCAGUA
   ||||| :||:||| |||||
aaaTGTCATGTTTATATGTCAT
mmu-miR-805 15.8271 -9.56 6.024580e-02 5.846690e-02 5.463290e-03 111 130
ggGAUACAGGACUAGUUAAG
  ||: || || ||::||||
tgCTGAGTACTAATTGATTC
hsa-miR-871 15.8042 -10.22 8.945280e-02 8.556860e-02 7.702440e-04 188 209
gUACUGACCGUGAUUAGACUUAU
 ||  ||  || | ||:||||||
aATTTCTCCCAAT-ATTTGAATA
hsa-miR-885-5p 15.7718 -11.53 3.799290e-02 3.728020e-02 9.788410e-04 330 351
ucuccgucccAUCACAUUACCU
          || |||:|||||
ctgtgatctcTATTGTGATGGA
hsa-miR-659 15.7718 -20.48 7.869430e-02 7.567760e-02 5.727090e-03 127 148
accccuGGGAGGGACUUGGUUc
      || |||:||||:||:
attcctCCATCCTTGAATCAGt
mml-miR-23a 15.7427 -9.79 8.267260e-02 7.934750e-02 5.917110e-03 377 397
cCUUUAGGGACCGUUACACUa
 ||  | |   | |||||||
tGACTTACAATGAAATGTGAa
hsa-miR-142-3p 15.6959 -11.93 7.625820e-02 7.342310e-02 6.713290e-03 247 269
agguauuucauccuUUGUGAUGu
              ||||||||
tgctttttcctgttAACACTACt
mml-miR-181a 15.6959 -12.84 7.771570e-02 7.477260e-02 7.461400e-04 333 355
ugaguGGCUGUCGCAACUUACAa
     :| |: |:| ||:||||
tgatcTCTATTGTGATGGATGTa
mmu-miR-878-3p 15.6631 -12.45 4.898270e-02 4.780240e-02 1.702370e-03 80 102
agAUGGGUCACA-CCACAGUACG
  |::|  || |   |||||||:
aaTGTCATGTTTATATGTCATGT
mmu-miR-466g 15.6334 -13.34 6.677300e-02 6.459250e-02 1.103780e-04 87 108
ACACACACGUA-CACAGACAUa
||| | | ::|  |||||||:
TGTTTATATGTCATGTCTGTGa
hsa-miR-768-3p 15.5807 -16.54 6.311020e-02 3.705970e-03 3.705970e-03 321 347
cAGUCGUCAAACUCACAGUCGUAACACU
 ||| ||   || |  ||  :|||||||
aTCAACATACTGTG-ATCTCTATTGTGA
hsa-miR-582-3p 15.5543 -8.19 5.992600e-02 5.816580e-02 3.796110e-03 129 150
ccaAGUCAACAAGUUGGUCAAu
   ||  |  || ||:|||||
tccTCCATCCTTGAATCAGTTc
hsa-miR-376b 15.5543 -13.14 8.963630e-02 8.573640e-02 8.303190e-03 28 48
UUGUACCUAAAAGGAGAUACua
|:||  || | ||:||||||
AGCA-AGACTGTCTTCTATGct
hsa-miR-509-3p 15.4455 -13.99 7.188960e-02 6.936640e-02 8.347760e-04 275 296
gaUGGGUGUCUGCAUGGUUAGu
  |:|||:  |   |:|||||
aaATCCATTAAAAAATCAATCt
hsa-miR-889 15.4148 -10.37 6.286320e-02 6.092810e-02 3.712230e-03 57 78
UGUUACCAACAGG-CUAUAAUU
:||||  ||||::  |||||||
GCAATCTTTGTTTATATATTAA
hsa-miR-376a 15.4148 -12.29 8.894410e-02 8.573640e-02 8.303190e-03 28 48
ugcacCUAAAAGGAGAUACua
     || | ||:||||||
agcaaGACTGTCTTCTATGct
hsa-miR-192 15.3054 -14.65 5.845880e-02 5.678290e-02 1.506300e-04 79 100
ccgACAGU-UAAGUAUCCAGUc
   ||||| :||:||| ||||
aaaTGTCATGTTTATATGTCAt
hsa-miR-638 15.2337 -22.62 9.715150e-02 9.258150e-02 5.670700e-03 316 340
uccGGCGGUGGGCGGGCGCUAGGGA
   :| :|| |   |:|:||||:||
attTCATCAACATACTGTGATCTCT
Features
AFFY_Rhesus MmuSTS.1311.1.S1_at
AFFY_Rhesus MmugDNA.11820.1.S1_at
HUGO 28908
spacer
spacer