spacer

Target Detailed View


Hit information for ENSMMUT00000026676

Gene Name N4BP1_HUMAN
Transcript ENSMMUT00000026676
Gene ENSMMUG00000018978
Description NEDD4-binding protein 1 (N4BP1) (Fragment). [Source:Uniprot/SWISSPROT;Acc:O75113]
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
hsa-miR-320 18.4351 -20.58 9.212380e-03 9.170080e-03 4.929650e-05 141 162
AGCGGGAGAGUUGGGUCGAAAA
| | ::|:  || |||||||||
TGGGTTTTCAAAACCAGCTTTT
hsa-miR-424 18.4351 -12.05 1.115380e-02 1.109180e-02 1.140840e-04 163 186
AAGUUUUGUACUUA--ACGACGAc
||| | |:|| |||  |||||||
TTCTATATATAAATTATGCTGCTa
mmu-miR-322 18.102 -12.91 1.535000e-02 1.523280e-02 6.886390e-06 163 186
AGGUUUUGUACUUA--ACGACGAc
|:| | |:|| |||  |||||||
TTCTATATATAAATTATGCTGCTa
mml-miR-23a 17.5262 -14.65 1.692570e-02 1.678330e-02 3.226780e-04 57 77
cCUUUAGGGACCGUUACACUa
 | | |:  ||| |||||||
tGTACTTGATGGGAATGTGAa
mml-miR-15a 17.4356 -16.84 2.416950e-02 2.416950e-02 2.751550e-05 166 186
GUGUUUGGUAAUACACGACGAU
:|:| |: | | | ||||||||
TATATATAAAT-TATGCTGCTA
mmu-miR-690 17.3246 -16.03 1.199870e-02 1.192700e-02 7.070850e-05 325 344
aaACCAACACUCGGAUCGGAAA
  ||| | ||:  :||||||||
aaTGGATATGG--TTAGCCTTT
hsa-miR-629 17.1913 -25.75 1.623980e-02 1.610860e-02 4.825110e-03 83 103
ucaAGAGGGUUGCAUUUGGGU
   |:|||||::|||||| ||
ttaTTTCCCAGTGTAAACGCA
mml-miR-103 17.129 -13.71 2.525640e-02 2.494010e-02 1.805460e-05 163 185
AGUAUCGGGACAUGUUACGACGA
|: ||  : |  |: ||||||||
TTCTATATATAAATTATGCTGCT
hsa-miR-195 17.0797 -14.46 3.090440e-02 3.043170e-02 3.053720e-04 163 186
cGGUUAUAAA---GACACGACGAU
 :| |||| |   :| ||||||||
tTCTATATATAAATTATGCTGCTA
hsa-miR-510 16.9914 -18.42 3.398920e-02 3.341810e-02 5.783230e-04 247 269
cACUAACGGUGA-GAGGACUCAU
 | || || ::| |||:|||||:
tTAATAGCAGTTACTCTTGAGTG
mml-miR-125b 16.9914 -15.84 2.408230e-02 2.379460e-02 1.900550e-04 10 30
AGUGUUCAAUCCCAGAGUCCCu
| | ||| | | | |||||||
TGAGAAGCTTGCG-CTCAGGGc
mml-miR-16 16.9914 -13.76 3.237460e-02 3.185620e-02 1.790000e-05 162 186
gcGGUUAUAAAU---GCACGACGAU
  :| |||| ||   : ||||||||
ttTCTATATATAAATTATGCTGCTA
rno-miR-349 16.8804 -18.25 4.207390e-02 4.120110e-02 4.120110e-02 12 32
UCUCCAAUUCUGUCGUCCCGAC
||| | | : :|  ||||||||
AGAAGCTTGCGC-TCAGGGCTG
hsa-miR-494 16.7693 -9.03 3.547390e-02 3.485210e-02 1.479720e-02 269 290
cuccAAAGGGCACAUACAAAGu
    || ||: | |||||||:
gtatTTACCTTTTTATGTTTTt
hsa-miR-497 16.7448 -12.56 4.542930e-02 4.441280e-02 3.057480e-05 167 186
UGUUUGGUGUCACACGACGAc
|:| | :| | | |||||||
ATATA-TAAATTATGCTGCTa
mmu-miR-351 16.7188 -20.99 4.255790e-02 4.166500e-02 4.166500e-02 5 30
GUCCGAGUUUCCCGA-G-GAGUCCCu
:: ||| |:| | :| | |||||||
TGTGCTGAGAAGCTTGCGCTCAGGGc
mml-miR-107 16.6869 -13.71 3.724360e-02 3.655860e-02 2.625250e-05 163 185
acuAUCGGGACAUGUUACGACGA
   ||  : |  |: ||||||||
ttcTATATATAAATTATGCTGCT
hsa-miR-485-5p 16.6583 -21.5 7.249010e-02 6.992500e-02 7.941250e-03 323 344
cUUAAGUAGUGCCGGUCGGAGA
 || | : :|:||::|||||:|
cAAATGGATATGGTTAGCCTTT
hsa-miR-641 16.6088 -14.78 4.587550e-02 4.483910e-02 3.389850e-03 264 290
cucCACUGAGAU---AGGAUACAGAAA
   |||  |:||   |::|||||:|||
tgaGTGTATTTACCTTTTTATGTTTTT
hsa-miR-298 16.6088 -17.22 5.670870e-02 5.513070e-02 2.534740e-02 211 233
acCCUCUUGGAGGGACGAAGACGa
  ||| |::|| | | :||||||
aaGGAAAGTCTACAT-TTTCTGCc
mml-miR-15b 16.5472 -14.07 4.874790e-02 4.757880e-02 2.751550e-05 164 186
ACAUUUG-GUACUACACGACGAU
| || |: :|   | ||||||||
TCTATATATAAATTATGCTGCTA
mmu-miR-743b-3p 16.4361 -8.29 6.798000e-02 6.798000e-02 1.195020e-02 268 291
AGAUAAGUCG--UACUACAGAAAG
| ||||:| |   | ||||:|||:
TGTATTTACCTTTTTATGTTTTTT
hsa-miR-376c 16.4099 -13.32 4.383050e-02 4.288380e-02 8.827920e-03 265 287
ugCACCUUAAAGG--AGAUACAA
  ||| | || ||  |:||||||
gaGTGTATTTACCTTTTTATGTT
hsa-miR-138 16.3554 -21.28 5.228030e-02 5.093720e-02 5.101130e-03 137 159
gccGGACUAAGUGUUGUGGUCGA
   |: |:||: ||| |||||||
aatCTGGGTTTTCAAAACCAGCT
hsa-miR-431 16.2982 -12.4 3.567950e-02 3.505050e-02 8.953810e-03 377 397
ACGUACUGCCGGACGUUCUGu
| : | | ||   |||||||
TTTCTTAAGGAAAGCAAGACc
mmu-miR-466f-3p 16.1866 -6.87 5.364740e-02 5.223380e-02 4.989140e-04 117 136
cacacauACACACACACAUAc
       ||| | |||||||
nnnnnnnTGT-TTTGTGTATa
mml-miR-181a 16.1344 -11.38 5.253520e-02 5.117910e-02 5.375480e-03 249 271
UGAGUGGCUGUCGCAACUUACAa
| | :| | :| : ||||:|||
AATAGCAGTTACTCTTGAGTGTa
mmu-miR-743a 16.103 -9.62 7.845780e-02 7.545890e-02 1.195020e-02 268 291
AGAUGAGUCG--AACCACAGAAAG
| ||:|:| |  ||  |||:|||:
TGTATTTACCTTTTTATGTTTTTT
mml-miR-30a-5p 15.8809 -10.43 6.283800e-02 6.090440e-02 6.178110e-03 229 251
GAAGGUCAGCUCCU-ACAAAUgu
|| || ||: || | ||||||
CTGCCTGTTCAGAACTGTTTAat
hsa-miR-134 15.7698 -15.58 6.576580e-02 6.364990e-02 1.057340e-02 238 261
ggggaGACCAGUUG--GUCAGUGu
     ||| |:||:  ||||:||
cagaaCTGTTTAATAGCAGTTACt
mmu-miR-683 15.6284 -13.24 9.251450e-02 8.836400e-02 2.674300e-02 236 257
cuccugUGUCGAA-UGUCGUCc
      || |:|| |:|||||
ttcagaACTGTTTAATAGCAGt
hsa-miR-887 15.5477 -17.2 2.778660e-02 2.740410e-02 1.643470e-04 219 240
ggagcccuaccGCGGGCAAGUg
           :|||:|||||
tctacattttcTGCCTGTTCAg
hsa-miR-633 15.3608 -4.73 9.290280e-02 8.871790e-02 1.224050e-02 279 301
AAAUAACACCAUCUAUGAUAAuc
|||  |||  |  | ||||||
TTTTATGTTTTTTAAACTATTtt
mml-miR-181a* 14.4372 -9.88 7.273520e-02 7.015300e-02 2.957300e-02 48 69
ccauguUAGUUGCCAGCUACCa
      | | ::  |:|||||
gctcacACCTGTACTTGATGGg
hsa-miR-574-3p 14.4372 -8.86 8.961530e-02 8.571720e-02 5.347870e-03 250 271
acacccacacacGUACUCGCAc
            | ||||:||
atagcagttactCTTGAGTGTa
Features
AFFY_Rhesus MmugDNA.9396.1.S1_at
Uniprot/SWISSPROT O75113
spacer
spacer