spacer

Target Detailed View


Hit information for ENSMMUT00000023881

Gene Name C12orf53
Transcript ENSMMUT00000023881
Gene ENSMMUG00000016994
Description ESRM828. [Source:Uniprot/SPTREMBL;Acc:Q6UX35]
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
hsa-miR-648 17.6291 -30.29 8.675270e-03 2.389510e-04 7.864860e-07 400 420
UGGUCAC--GGGACGUGUGAA
::|||||  :|||||||||||
GTCAGTGTTTCCTGCACACTT
gga-miR-757 17.051 -23.3 3.793570e-02 3.722520e-02 7.270470e-04 948 968
cUUAGGGUAGACGUCGAGACG
 ||  ||||: | ||||||||
cAAGGCCATTAGGAGCTCTGC
hsa-miR-650 16.8504 -25.33 5.759820e-02 5.597080e-02 6.728770e-03 953 973
cagGACUCUCGCGACGGAGGa
   :| :|||| ||||||||
ccaTTAGGAGCTCTGCCTCCa
hsa-miR-604 16.8186 -25.27 2.063380e-02 2.042240e-02 1.124280e-02 497 515
caGGACUUAAGGCGUCGGa
  ||| : ||||||||||
caCCTCGTTTCCGCAGCCc
hsa-miR-299-3p 16.7721 -17.96 2.328760e-02 2.301850e-02 9.030940e-06 357 378
uuCGCCAAAUGGUAGGGUGUAu
  ||  ||| || ||||||||
ttGCACTTTTCCTTCCCACATt
hsa-miR-648 16.7173 -22.41 2.202190e-02 2.389510e-04 7.864860e-07 240 258
UGGUCACGGGACGUGUGAa
|: |  |||:||||||||
ATGAAAGCCTTGCACACTc
mmu-miR-466h 16.5724 -20.09 5.237980e-02 7.618560e-05 5.346060e-07 237 257
aUGUGUGUUCGUGUACGUGUGu
 |||:: |||| | |||||||
cACATGAAAGC-CTTGCACACt
hsa-miR-345 16.3728 -28.77 4.023190e-02 3.943330e-02 2.500230e-02 922 942
cuCGGGACCUGAUCCUCAGUCG
  |||  |||| | ||||||||
ctGCCAGGGACCA-GAGTCAGC
hsa-miR-146b-3p 16.2729 -32.08 5.867420e-02 5.698600e-02 3.582360e-03 83 104
ggUCUUGACUCAGGUGUCCCgu
  :||:|||:| ||||||||
ggGGAGCTGGGGCCACAGGGgc
hsa-miR-432 16.201 -25.36 8.405060e-02 8.061530e-02 3.258800e-04 614 634
GGUGGGUUACUGGAUGAGGUUCU
:| ||| ||  || ||||||||:
TCTCCCCAT--CCCACTCCAAGG
mmu-miR-434-3p 15.9734 -20.4 3.365030e-02 3.309040e-02 8.055100e-03 928 951
UCCUCAGCUCA--CUACCAAGUUU
:|||   ||||  | ||||||||:
GGGACCAGAGTCAGCTGGTTCAAG
mmu-miR-466f-3p 15.9477 -19.81 6.352860e-02 7.618560e-05 5.346060e-07 822 842
cacACAUACACACACACAUAC
   ||  ||| |||||||:||
tccTGGCTGTCTGTGTGTGTG
mmu-miR-681 15.9477 -24.99 6.215010e-02 6.025820e-02 4.355990e-03 905 924
ucGACGGACGGUCGCUCCGAC
  ||  || ||| ||||||||
ccCTAACT-CCACCGAGGCTG
mml-miR-19a 15.9029 -9.23 6.969370e-02 4.054020e-03 4.054020e-03 340 363
AGUCAAAACGUA-UCUAAACGUGu
||  | |||: | | ||||||||
TCTCTCTTGTCTCACATTTGCACt
mml-miR-103 15.8035 -25.14 8.514660e-02 8.162240e-02 7.297320e-06 507 527
aGUAUCGGGACAUGUUACGACGA
 |: |||||  |:| ||||||||
cCGCAGCCC-CTGC-ATGCTGCT
mmu-miR-470 15.8035 -22.87 9.119540e-02 8.716070e-02 1.443460e-03 614 635
uGAGUGGUCACGGUCAGGUUCUU
 ||| ||| | ||| ||||||::
tCTCCCCA-TCCCACTCCAAGGG
mmu-miR-695 15.7738 -23.68 6.249560e-02 6.058280e-02 1.613040e-02 871 892
aaGUCAGUGGAUACGGGUUAGA
  ||||| :|  | ||||:|||
gcCAGTCCTCCCTTCCCAGTCT
mmu-miR-463 15.7738 -16.31 4.555530e-02 4.453320e-02 3.152250e-02 803 824
gAUGGAAUAUACCACAGAUAGu
 | |||| |:|  |||||:||
gTCCCTTTTGTCTTGTCTGTCc
hsa-miR-483-5p 15.5741 -21.92 9.097870e-02 8.696280e-02 1.682830e-03 331 352
GAGGGAAGAAAGGAGGGCAGAa
|||:| | || :|||::||||
CTCTCATGTTCTCTCTTGTCTc
hsa-miR-371-3p 15.5053 -26.52 4.092960e-02 4.010330e-02 1.169000e-03 624 646
uGUGAGUUUUCUACCGCCGUGaa
 ||||| ||:|:|| |||||:
cCACTCCAAGGGTGCCGGCATca
mmu-miR-466g 15.4462 -16.24 7.855740e-02 7.618560e-05 5.346060e-07 816 837
ACACACACGUAC-ACAGACAUA
||| ||| |  | |||||||:|
TGTCTGTCCTGGCTGTCTGTGT
mml-miR-19b 15.4059 -14.41 9.286440e-02 4.054020e-03 4.054020e-03 263 286
aGUCAAAACGUAC-CUAAACGUGU
 ||  ||  || |  |||||||||
cCACCTTCACAGGCCATTTGCACA
mmu-miR-711 15.3744 -27.3 7.575620e-02 7.295780e-02 3.068050e-02 195 216
GAAUGUAGAGAGGGGCCCAGGG
| ||: | |  |:::|||||||
CATATCTGTGACTTTGGGTCCC
hsa-miR-379 15.2456 -19.49 7.705890e-02 7.416470e-02 3.298340e-02 877 896
GGAUGCAAGGUAUCAGAUGGu
||| | ||||  |||||:||
CCTCCCTTCC-CAGTCTGCCt
hsa-miR-147b 15.0749 -22.99 6.756860e-02 6.533640e-02 1.347680e-04 395 418
aUCGUC-UUCGUAAA-GGCGUGUG
 :|::|  ||::||| |:||||||
cGGTGGTCAGTGTTTCCTGCACAC
Features
AFFY_Rhesus MmugDNA.27231.1.S1_at
AFFY_Rhesus MmugDNA.29148.1.S1_at
HUGO 25338
spacer
spacer