spacer

Target Detailed View


Hit information for ENSMMUT00000021687

Gene Name PXMP2
Transcript ENSMMUT00000021687
Gene ENSMMUG00000015464
Description Peroxisomal membrane protein 2 (22 kDa peroxisomal membrane protein). [Source:Uniprot/SWISSPROT;Acc:Q9NR77]
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
hsa-miR-624 20.3237 -22.26 1.405760e-03 1.404770e-03 1.404770e-03 152 172
uccAUUAUGGUUAUGGAACAC
   ||||::||: ||||||||
tctTAATGTCAGAACCTTGTG
mmu-miR-699 19.9783 -29.43 1.539010e-03 1.539010e-03 1.414090e-03 78 98
GCUCGGUCCAGC-GUGACGGA
| ||:|||| || ||||||||
CCAGTCAGGACGTCACTGCCT
mml-miR-29a 19.4213 -25.41 1.488160e-03 1.487050e-03 1.092950e-05 188 209
uUGGCUAAAGUCUACCACGAUc
 :|:|| ||||| |||||||:
cGCTGACTTCAGCTGGTGCTGc
mmu-miR-465a-5p 18.8717 -18.81 9.177670e-03 9.177670e-03 6.046580e-03 85 105
agUGUAGUCACGGUAAGAUUUAu
  ||:||| ||||  |||||||
ggACGTCACTGCC--TCTAAATc
hsa-miR-449b 18.6263 -25.46 6.618600e-03 6.618600e-03 4.446540e-04 77 98
cGGUCGAUUGUUAUGUGACGGA
 ||||: |: |   ||||||||
cCCAGTCAGGACGTCACTGCCT
mmu-miR-465b-5p 18.3991 -14.63 1.309400e-02 1.309400e-02 6.046580e-03 83 105
GUCUAGUCGUGGU-AAGAUUUAu
|||: |: |||::  |||||||
CAGGACGTCACTGCCTCTAAATc
hsa-miR-612 18.1358 -31.96 2.490850e-02 2.460080e-02 9.137090e-03 35 62
uuCCUCGAGUCUUCG---GGACGGGUCG
  ||: || :|:: |   ||||||||||
gtGGGTCTGGGGGTCTTACCTGCCCAGC
hsa-miR-449a 18.0584 -23.32 1.163400e-02 1.156660e-02 4.446540e-04 77 98
uGGUCGAUUGUUAUGUGACGGu
 ||||: |: |   |||||||
cCCAGTCAGGACGTCACTGCCt
hsa-miR-486-3p 18.0401 -24.91 1.826430e-02 1.809850e-02 1.475100e-02 192 213
uaGGACAUGACU-CGACGGGGc
  |:|  :|||: ||||||||
gaCTTCAGCTGGTGCTGCCCCa
mmu-miR-720 18.0147 -21.95 8.931950e-03 8.892180e-03 8.892180e-03 50 67
accuccgGGGUCGCUCUa
       ||||||||||
ttacctgCCCAGCGAGAg
mml-miR-34a 17.9448 -21.69 1.394900e-02 1.385220e-02 1.196940e-05 78 98
uGUUGGUCGAUUCUGUGACGGu
 ||::|||  | | |||||||
cCAGTCAG-GACGTCACTGCCt
mmu-miR-465c-5p 17.7177 -13.53 1.899430e-02 1.881500e-02 6.046580e-03 86 105
gUCUAGUCGCGGUAAGAUUUAu
 | :||| :|||  |||||||
gACGTCACTGCC--TCTAAATc
mml-miR-128a 17.7177 -17.73 1.332420e-02 1.323580e-02 5.281500e-05 10 32
UUUUCUCUGG-CCAAGUGACACU
::|: | |:| | | |||||||:
GGAGAACATCAGATGCACTGTGG
mmu-miR-676 17.6976 -22.53 9.653790e-03 9.607340e-03 9.607340e-03 66 90
UCGAGUU-GUUGG---AGUCCUGCc
|||  || |||||   ||||||||
AGCAGAACCAACCCAGTCAGGACGt
hsa-miR-802 17.2896 -16.16 2.213140e-02 2.188830e-02 2.188830e-02 228 253
uguUCCUACUUAGA---AACAAUGAC
   || :  |||:|   |||||||||
agtAGAGGCAATTTCAATTGTTACTG
hsa-miR-361-3p 17.2896 -19.81 3.525440e-02 3.464020e-02 4.512260e-03 26 48
uuuaGUCUUAGUGUGGACCCCCu
    ::||  :: ::|||||||
actgTGGACGTGGGTCTGGGGGt
hsa-miR-576-5p 17.2634 -16.28 2.057770e-02 2.036740e-02 2.036740e-02 247 269
uuucuGCACCU-CUUUAAUCUUA
     :|||||  :||||||:||
gttacTGTGGACCGAATTAGGAT
hsa-miR-139-5p 17.2634 -20.38 1.420260e-02 2.743700e-03 2.743700e-03 12 33
gaccucuGUGCACGUGACAUCU
       ||  ||||||||:||
agaacatCAGATGCACTGTGGA
hsa-miR-650 17.1267 -19.07 4.553740e-02 4.451610e-02 4.451610e-02 81 101
CAGGACUCUCGCGACGGAGGa
|||  || : | |||||||:
GTCAGGACGTCACTGCCTCTa
hsa-miR-148b 17.0362 -16.58 1.708200e-02 1.708200e-02 5.579860e-03 9 30
uguuucaagacaCUACGUGACu
            |||||||||
gggagaacatcaGATGCACTGt
hsa-miR-662 17.0125 -20.11 1.591570e-02 1.578970e-02 1.578970e-02 19 40
GACGACCCGGUG-UUGCACCCu
| | ||  |::: :|||||||
CAGATGCACTGTGGACGTGGGt
mmu-miR-680 16.8983 -19.88 3.234740e-02 3.182980e-02 1.441550e-03 103 123
gGGGGUACAGUCGUCUACGGG
 :|  :|| :   ||||||||
aTCAGGTGATTCAAGATGCCC
hsa-miR-616 16.5819 -19.54 3.293130e-02 3.239500e-02 5.826760e-03 282 303
gacgaGUUUGGGAGGUUACUGa
     :|::|:||:|||||::
taatgTAGGCTCTTCAATGGTg
hsa-miR-769-5p 16.5819 -25.49 3.694970e-02 3.627540e-02 3.627540e-02 31 52
ucgaguCUUGGGUCUCCAGAGU
      |:::|::|:|||||:|
ggacgtGGGTCTGGGGGTCTTA
hsa-miR-152 16.5558 -13.04 3.193120e-02 3.142680e-02 1.007060e-02 10 30
gguucaagacagUACGUGACu
            ||||||||
ggagaacatcagATGCACTGt
hsa-miR-499-5p 16.5558 -16.58 4.299350e-02 4.208240e-02 2.697640e-04 31 53
UUUGUAGU--GACGUUCAGAAUu
::||:| :  ||| ::||||||
GGACGTGGGTCTGGGGGTCTTAc
mml-miR-27a 16.3548 -14.99 5.284080e-02 2.014160e-03 5.922100e-05 236 257
ccgccuugaAUCGGUGACACUU
         | |::||||||:|
caatttcaaTTGTTACTGTGGA
hsa-miR-653 16.3275 -17.68 4.631080e-02 4.525480e-02 4.525480e-02 227 247
GUCAUCUCUAACAAAGUUGug
:|||||||:   ||||||:
TAGTAGAGGCAATTTCAATtg
mml-miR-196 16.3275 -16.09 5.067320e-02 4.941070e-02 4.941070e-02 78 99
GGUU-GUUGUACUUUGAUGGAu
|||: ||: | |  |||:|||
CCAGTCAGGACGTCACTGCCTc
hsa-miR-593 16.2852 -19.24 9.336380e-02 8.913790e-02 2.758910e-02 219 237
ucUUUGGGGUCGUCUCUGU
  ||  :::||:||||:||
ttAACATTTAGTAGAGGCA
mmu-miR-686 16.2412 -12.18 4.192020e-02 4.105370e-02 4.105370e-02 217 239
aGAAGUGGCAGAC-CCUUCGUUA
 ||| ||  |: |  ||:|||||
aCTTAACATTTAGTAGAGGCAAT
hsa-miR-876-5p 16.1276 -10.91 6.796940e-02 6.571090e-02 8.371120e-04 132 153
ACCACUAAGUGUUUCUUUAGGu
|||  |   | | |||||||:
TGGATAGAGAAACAGAAATCTc
mml-miR-27a 16.1276 -21.57 6.485230e-02 2.014160e-03 5.922100e-05 9 33
CCGCCUUG-AAUC--GGUGACACUU
||  |||| | ||   |||||||:|
GGGAGAACATCAGATGCACTGTGGA
hsa-let-7d 16.1276 -15.98 9.180300e-02 8.771510e-02 1.239840e-05 80 100
UUGAUACGUUGGAUGAUGGAGA
|:: | |  ::| |||:|||||
AGTCAGGACGTC-ACTGCCTCT
hsa-miR-148a 16.1276 -13.39 4.416390e-02 4.320290e-02 5.579860e-03 8 30
ugUUUCAAGACAUC-ACGUGACu
  ::||  |   || |||||||
tgGGAGAACATCAGATGCACTGt
mml-miR-98 16.1276 -16.9 9.223250e-02 8.810690e-02 1.118570e-03 77 100
uuGUUA-UGUUG-AAUGAUGGAGu
  ||:| | :|| | |||:||||
ccCAGTCAGGACGTCACTGCCTCt
mmu-miR-741 16.0466 -13.79 7.062780e-02 6.819130e-02 1.853410e-02 134 156
agAUGUAUCUUACCGUAGAGAGU
  || | | |  |  ||||||:|
gaTAGAGAAACAGAAATCTCTTA
mml-miR-33 15.9387 -9.52 5.994770e-02 5.818620e-02 2.721400e-07 272 289
GUUACGUUGAUGUUACGUg
||||  ||| |:||||:|
CAAT-AAACAATAATGTAg
gga-miR-460 15.9005 -17.72 6.519290e-02 6.311330e-02 2.793550e-04 269 290
gugugucacacaUGUUACGUCC
            |:||||:|||
tcacaataaacaATAATGTAGG
mml-miR-124a 15.9005 -18.02 6.693920e-02 6.474790e-02 2.186310e-06 157 178
accguaagUGGCGCACGGAAUU
        ||| :|||::||||
atgtcagaACCTTGTGTTTTAA
hsa-miR-151-5p 15.7566 -14.2 4.710700e-02 4.601470e-02 2.117350e-03 278 298
UGAUCUGACACUCGAGGAGcu
|| | | ||| :||||:||
ACAATAATGTAGGCTCTTCaa
mmu-miR-699 15.73 -15.75 8.808110e-02 3.658700e-03 1.414090e-03 192 211
gcucGGUCCAGCGUGACGGa
    :||| | |::|||||
gactTCAGCTGGTGCTGCCc
mml-miR-103 15.7076 -14.8 9.279680e-02 8.862130e-02 2.466080e-05 187 210
AGUAUCGGGACAUG-UUACGACGa
||:  | |:|  :| ::||||||
TCGCTGACTTCAGCTGGTGCTGCc
mmu-miR-291b-3p 15.6733 -13.93 9.685680e-02 9.231400e-02 1.087400e-02 8 30
ugUUUGUUUUA-CCUACGUGAaa
  ::| || ||  ||||||||
tgGGAGAACATCAGATGCACTgt
hsa-miR-139-5p 15.5597 -13.7 7.597070e-02 2.743700e-03 2.743700e-03 235 257
gaccucuGUGCAC-GUGACAUCU
       ||  || :|||||:||
gcaatttCAATTGTTACTGTGGA
hsa-miR-542-5p 15.3686 -19.81 5.768960e-02 5.605710e-02 2.092350e-03 104 125
AGAGCACUGUACUACUAGGGGCU
||  ||||: | | ||| |||||
TCAGGTGAT-TCAAGATGCCCGA
hsa-miR-574-3p 14.8783 -17.83 5.955700e-02 5.781820e-02 4.035700e-03 28 49
ACACCCACACACGUACUCGCAc
|||||  ||| |: ||:| ||
TGTGGACGTGGGTCTGGGGGTc
Features
AFFY_Rhesus MmugDNA.33433.1.S1_at
HUGO 9716
spacer
spacer