spacer

Target Detailed View


Hit information for ENSMMUT00000013271

Gene Name ASB1
Transcript ENSMMUT00000013271
Gene ENSMMUG00000009511
Description Ankyrin repeat and SOCS box protein 1 (ASB-1). [Source:Uniprot/SWISSPROT;Acc:Q9Y576]
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
hsa-miR-570 18.2322 -12.79 1.915760e-02 1.897530e-02 3.357330e-03 197 218
cGUUUCCAUUAACGACAAAAGc
 |||| || ||| :||||||:
aCAAAAGTTATTATTGTTTTTc
hsa-miR-185 18.0126 -25.72 2.119610e-02 2.097300e-02 2.097300e-02 338 359
AGUCCUUGACGGAAAGAGAGGU
|| |||||||:  ||||||::|
TCTGGAACTGTGCTTCTCTTTA
mmu-miR-322 18.0126 -24.39 1.656930e-02 1.643280e-02 1.831970e-03 60 85
aGGUUUUGUACUUA----ACGACGAC
 ||||| | |||:|    ||||||||
aCCAAACCCTGAGTGCTGTGCTGCTG
hsa-miR-455-3p 17.9947 -21.43 8.405140e-03 8.369920e-03 8.369920e-03 110 132
cACAUAUACGG--GUACCUGACG
 || | |||:|  |:|||||||:
cTGAAGATGTCATCGTGGACTGT
hsa-miR-195 17.8843 -23.05 1.570190e-02 1.557930e-02 6.709190e-05 65 85
cGGUUAUAAAGACACGACGAU
 ||   | | ||||||||||:
aCCCTGAGTGCTGTGCTGCTG
mml-miR-15b 17.7929 -23.44 1.677840e-02 8.989890e-04 3.419530e-06 60 85
acaUUUGGUACU----ACACGACGAU
   ||||| |||    |||||||||:
accAAACCCTGAGTGCTGTGCTGCTG
hsa-miR-497 17.7739 -25.78 1.905480e-02 1.887440e-02 8.461360e-05 61 85
uGUUUGG----UGUCACACGACGAC
 ||||||    ::: ||||||||||
cCAAACCCTGAGTGCTGTGCTGCTG
hsa-miR-548d-5p 17.6831 -14.85 4.288820e-02 4.288820e-02 2.111030e-03 196 217
ccGUUUUUGGUGUUAAUGAAAA
  |||||:::|: |||::||||
taCAAAAGTTATTATTGTTTTT
mml-miR-15a 17.4634 -24.08 2.360110e-02 8.989890e-04 3.419530e-06 60 85
guGUUUGGUAAU----ACACGACGAU
  |||||| | |    |||||||||:
acCAAACCCTGAGTGCTGTGCTGCTG
hsa-miR-424 17.4634 -19.88 2.562830e-02 2.530270e-02 1.722360e-03 60 85
aaGUUUUGUACUUA----ACGACGAC
  |||| | |||:|    ||||||||
acCAAACCCTGAGTGCTGTGCTGCTG
hsa-miR-623 17.2693 -21.05 2.340890e-02 2.313700e-02 2.313700e-02 12 34
ugGGUUGUCGGGGACGUUCCCUa
  | : :: ::|| ||||||||
tgCGGTTGATTCCAGCAAGGGAg
mmu-miR-327 17.191 -23.83 2.426200e-02 2.397000e-02 4.274780e-03 128 147
UAGGAGU-ACGGGGAGUUCA
| : ||| |||:|||||:||
ACTGTCATTGCTCCTCAGGT
hsa-miR-634 17.1339 -16.21 1.395820e-02 1.386120e-02 4.934940e-03 65 88
caGGUUUCA--ACCCCACGACCAa
  || :|||  || | |||||||
acCCTGAGTGCTGTGCTGCTGGTg
mmu-miR-763 17.1339 -22.1 2.946910e-02 2.903910e-02 1.643280e-04 165 187
CGGUGACCAAG-AAGGGUCGACc
|:| :||| || || :||||||
GTCCTTGGGTCATTGTCAGCTGa
mmu-miR-343 17.0932 -15.86 3.780690e-02 3.710110e-02 1.189610e-03 16 35
aGACCCGUGUACUUCCCUCU
 :||  : ||  ||||||||
gTTGATTCCAGCAAGGGAGA
mmu-miR-295 16.9414 -14.89 3.805460e-02 3.733960e-02 8.434430e-03 317 339
ucugagUUUUCAUCAUCGUGAAa
      |::| |  ||||||||
gtagggAGGACTCCTAGCACTTc
hsa-miR-489 16.9142 -19.33 1.418580e-02 1.408570e-02 5.794060e-04 100 122
CGACGGC-AUAUACACUACAGUG
||||::| ||     |||||||:
GCTGTTGCTACTGAAGATGTCAT
hsa-miR-548b-5p 16.8044 -10.35 7.843820e-02 7.544080e-02 2.111030e-03 196 217
ccGGUUUUGGUGUUAAUGAAAA
  | |||:::|: |||::||||
taCAAAAGTTATTATTGTTTTT
hsa-miR-556-3p 16.8044 -16.71 1.875670e-02 1.858190e-02 1.858190e-02 71 92
UUUCUACUCGAUUACCAUUAUA
|: | || |||: ||||::|||
AGTGCTGTGCTGCTGGTGGTAT
hsa-miR-548c-5p 16.8044 -11.32 7.034980e-02 7.034980e-02 2.111030e-03 196 217
ccGUUUUUGGCGUUAAUGAAAA
  |||||::: : |||::||||
taCAAAAGTTATTATTGTTTTT
mml-miR-103 16.7228 -23.86 3.678980e-02 3.612130e-02 1.667720e-05 61 84
aGUAUCGGG-ACAUGUUACGACGA
 || | ||:  ||:| :|||||||
cCAAACCCTGAGTGCTGTGCTGCT
hsa-miR-134 16.6946 -22.73 2.718650e-02 2.682030e-02 2.682030e-02 228 249
GGGGAGACCAGUUGGUCAGUGU
|:::||||| :  :||||::||
CTTTTCTGGATTTTCAGTTGCA
hsa-miR-510 16.6946 -21.84 4.455080e-02 4.357300e-02 1.024240e-02 54 74
CACUAACGGUGAGAGGACUCAU
|||:   |||  | |||||||:
GTGGACACCAAAC-CCTGAGTG
mml-miR-15b 16.6946 -22.87 4.301380e-02 8.989890e-04 3.419530e-06 85 109
aCAUU-UGGUACUAC--ACGACGAU
 ||:: |:| |||||  ||:|||||
gGTGGTATCCTGATGGCTGTTGCTA
mml-miR-198 16.6329 -17.72 4.095440e-02 4.012710e-02 9.702510e-03 220 239
ggaUAA-AGGGGAGACCUGG
   ||| ||:::||||||::
caaATTCTCTTTTCTGGATT
hsa-miR-372 16.6135 -12.59 6.493350e-02 6.287020e-02 1.156360e-02 317 339
ugcgagUUUACAGCGUCGUGAAa
      |::  || :|||||||
gtagggAGGACTCCTAGCACTTc
mml-miR-107 16.6135 -23.86 3.984340e-02 3.906010e-02 2.239940e-05 60 84
acuaUCGGGA--CAUGUUACGACGA
    | ||||  ||:| :|||||||
accaAACCCTGAGTGCTGTGCTGCT
mml-miR-16 16.5847 -19.98 4.556370e-02 4.454130e-02 1.885540e-04 64 85
gcGGUUAUAAAUGCACGACGAU
  ||   | |  :||||||||:
aaCCCTGAGTGCTGTGCTGCTG
hsa-miR-520e 16.5595 -20.49 5.892020e-02 3.414020e-03 3.414020e-03 314 339
GGGAGUUUUUCCU-----UCGUGAAa
||: :|:::||||     |||||||
CCTGTAGGGAGGACTCCTAGCACTTc
mml-miR-215 16.4491 -14.75 1.848830e-02 1.831840e-02 2.885160e-03 157 177
cagacaGUUAAGUAUCCAGUA
      ||:| | |:||||||
gccgaaCAGTCCTTGGGTCAT
hsa-miR-564 16.4096 -21.28 4.103660e-02 4.020600e-02 3.127210e-02 334 352
cgGACGACUGUGGCACGGA
  || |||: ||:||||:|
caCTTCTGGAACTGTGCTT
mmu-miR-883a-3p 16.3651 -17.04 3.190640e-02 3.434500e-03 1.635290e-04 1 19
uaUGACUCUCGACAACGUCAAU
  |||  ||| || |||:|||:
--ACTTCGAG-TGCTGCGGTTG
mmu-miR-883b-3p 16.3651 -17.04 3.494000e-02 3.434500e-03 1.635290e-04 1 19
uaUGACUCUCUACAACGUCAAU
  |||  ||| || |||:|||:
--ACTTCGAG-TGCTGCGGTTG
hsa-miR-520a-5p 16.3387 -13.64 6.608710e-02 3.414020e-03 3.414020e-03 218 238
ucuUUCAUGAAGGGAGACCUc
   || | || :::||||||
cccAAATTCTCTTTTCTGGAt
hsa-miR-433 16.2552 -20.79 3.239800e-02 3.187880e-02 3.187880e-02 107 128
uGUGGCUCCUCGGGUAGUACUa
 :||:|| ||  :||||:||:
cTACTGAAGATGTCATCGTGGa
hsa-miR-375 16.2552 -23.19 1.735100e-02 1.720130e-02 8.104650e-03 146 166
aGUGCGCUCGGCUUGCUUGUUu
 ::| :|:||||  ||||||:
gTGCCTGGGCCG-CCGAACAGt
hsa-miR-640 16.2283 -18.71 4.043090e-02 3.962450e-02 8.914200e-03 157 177
ucuccgucCAAGGACCUAGUA
        || |:|||:||||
gccgaacaGTCCTTGGGTCAT
hsa-miR-520b 16.2283 -22.03 7.735220e-02 3.414020e-03 3.414020e-03 313 339
GGGAGAU-UUUCCU-----UCGUGAAa
|||| || ::||||     |||||||
CCCTGTAGGGAGGACTCCTAGCACTTc
hsa-miR-151-5p 16.2283 -25.33 2.836080e-02 2.796240e-02 2.986890e-03 123 145
ugAUCUGACACU--CGAGGAGcu
  |:|||||| |  |||||||
cgTGGACTGTCATTGCTCCTCag
hsa-miR-611 16.1763 -25.81 2.473410e-02 2.443070e-02 7.129240e-05 149 172
caGUCUGG-GGCUCCCCAGGAGCg
  ::|:|| ||||   |||||:|
ccTGGGCCGCCGAACAGTCCTTGg
hsa-miR-627 16.1454 -18.11 4.393110e-02 4.298010e-02 2.685130e-02 175 196
aggagaaaaGAAUCUCUGAGUG
         || ||||:||||:
cattgtcagCTGAGAGGCTCAT
hsa-miR-520c-3p 16.1454 -23.37 8.499800e-02 3.414020e-03 3.414020e-03 312 339
uGGGAGAU-UUUCCU-----UCGUGAAa
 |||| || ::||||     |||||||
tCCCTGTAGGGAGGACTCCTAGCACTTc
mmu-miR-695 16.0356 -9.31 4.710060e-02 4.600860e-02 4.600860e-02 356 378
AAGUCAGUGGAU-ACGGGUUAGA
||:| |: :||| | |:||||:|
TTTATTTTTCTACTTCTCAATTT
hsa-miR-548d-3p 16.0356 -11.02 6.575060e-02 6.575060e-02 2.111030e-03 197 218
cGUUUUCUUUGACACCAAAAAc
 ||||||  |:| | ||||||
aCAAAAGTTATTATTGTTTTTc
hsa-miR-553 16.0075 -13.18 5.791830e-02 5.627300e-02 3.619930e-03 194 216
uUUUGUUUU--AGAGUGGCAAAA
 | ||||||  | |:|::|||||
cATACAAAAGTTATTATTGTTTT
hsa-miR-298 15.9926 -28.32 9.772310e-02 9.310000e-02 1.034650e-02 319 343
aCCCUCUUGGAGGGAC--GAAGACga
 |||||:| ||||: |  ||||||
aGGGAGGA-CTCCTAGCACTTCTGga
hsa-miR-769-3p 15.9577 -28.41 7.865420e-02 7.564050e-02 2.294180e-02 2 26
uuGGUUC-UGGGGCC-UCUAGGGUC
  :|:|| :|: |||  |||:||||
ctTCGAGTGCTGCGGTTGATTCCAG
hsa-miR-7 15.9577 -15.61 9.075650e-02 8.675990e-02 1.830940e-05 195 219
UGUUGUUUUAGUGAU--CAGAAGGu
|:|  |||:|:|:||  ||:||:|
ATACAAAAGTTATTATTGTTTTTCc
mml-miR-135 15.9577 -16.97 8.920650e-02 8.534330e-02 7.283480e-03 245 269
AGUGUAUCCUU--AUUUUUCGGUAU
|::||||  ||  ||| ::|||||:
TTGCATATTAATGTAACGGGCCATG
mmu-miR-883b-5p 15.9257 -12.51 8.526000e-02 3.434500e-03 1.635290e-04 225 246
acuGACGAUGGGUAAGAGUCAu
   || :| :  |||:|||||
tctCTTTTCTGGATTTTCAGTt
hsa-miR-192 15.8971 -12.51 3.314300e-02 3.259980e-02 6.701490e-03 157 177
ccgacaGUUAAGUAUCCAGUc
      ||:| | |:|||||
gccgaaCAGTCCTTGGGTCAt
mmu-miR-351 15.8838 -24.54 8.384550e-02 8.042670e-02 2.509490e-02 125 148
GUCCGAGUUUCCCGAGGAGUCCcu
::| ||   |  ||||||||||
TGGACTGTCATTGCTCCTCAGGtg
hsa-miR-632 15.8515 -18.21 8.134640e-02 7.812570e-02 2.405220e-02 43 61
aggGUGUCCUUCGUCUGUG
   || || |:|::|||||
ctgCAGAGAAGGTGGACAC
mmu-miR-678 15.8159 -21.77 4.441640e-02 4.344440e-02 5.160050e-04 167 190
GGAGGUCAGGAACG--UGGCUCUg
|||: :||| |||:  :|:||||
CCTTGGGTCATTGTCAGCTGAGAg
hsa-miR-337-3p 15.8159 -16.27 4.716580e-02 4.607080e-02 1.047070e-02 266 288
cUUCUUUCCGUA-GUAUAUCCUc
 | |:|| |::| |||:||||:
cATGGAATGTGTACATGTAGGGa
hsa-miR-621 15.7867 -21.53 4.062350e-02 3.980940e-02 2.738210e-03 66 88
uccAUUCGCGACA--ACGAUCGg
   |:||:|||||  ||||:|:
cccTGAGTGCTGTGCTGCTGGTg
hsa-miR-550 15.7391 -22.31 8.027360e-02 7.713620e-02 1.814890e-04 126 150
CCCGAGAAUGA--GGGAGUCCGUGa
|| || | |:|  :|||||||::|
GGACTGTCATTGCTCCTCAGGTGCc
hsa-miR-450b-3p 15.4864 -18.72 9.394640e-02 8.966840e-02 2.942080e-02 6 26
auacCUACGUUUUACUAGGGUU
    | ||| :: ||||:|||:
gagtGCTGC-GGTTGATTCCAG
hsa-miR-212 15.4555 -19.46 6.300030e-02 2.341970e-03 1.425820e-04 85 106
CCGGCA-CUGACCUCUGACAAU
||: ||   |||  |:|||||:
GGTGGTATCCTGATGGCTGTTG
hsa-miR-212 15.3451 -12.97 7.005140e-02 2.341970e-03 1.425820e-04 114 134
cCGGCACUGACCUCUGACAau
 | :|| |: | :||||||
aGATGTCATCGTGGACTGTca
mmu-miR-685 15.3451 -15.23 9.410800e-02 8.981550e-02 2.648790e-03 160 180
cacggaguGGAGUCGGUAACu
        |:| :|:|||||
gaacagtcCTTGGGTCATTGt
hsa-miR-132 15.2667 -16.49 7.718690e-02 7.428320e-02 2.234240e-02 85 106
gcugguaccGACAUCUGACAAU
         |||  |:|||||:
ggtggtatcCTGATGGCTGTTG
hsa-miR-943 15.2348 -17.3 8.283840e-02 7.950010e-02 2.467330e-02 150 169
GACCUCCUGCCGUUGUCAGuc
||||:  :| | |||||||
CTGGGCCGCCG-AACAGTCct
hsa-miR-628-5p 15.1569 -14.07 9.607390e-02 9.160310e-02 3.035350e-02 104 125
GGAGAUCAUUUAUACAGUCGUA
:: ||| |:|| |||||| |:|
TTGCTACTGAAGATGTCATCGT
mmu-miR-719 15.1569 -15.68 9.920970e-02 9.444720e-02 3.174130e-02 168 190
uuguaaaaaGACA-UCGGCUCUa
         :||| |||:||||
cttgggtcaTTGTCAGCTGAGAg
hsa-miR-409-5p 15.0833 -19.33 6.819430e-02 6.592100e-02 2.864650e-04 72 95
UACGUUUCAACGAGC-CCAUUGGA
:||| : | |||| | |||| |||
GTGCTGTGCTGCTGGTGGTATCCT
mmu-miR-701 15.014 -14.7 5.922870e-02 5.750880e-02 1.242160e-03 1 20
agGUAGAUAAAGUCGCCGAUU
  | || | | | ||||:|:|
-aCTTCGAGTGCTGCGGTTGA
hsa-miR-369-5p 14.9372 -20.82 3.664920e-02 3.598570e-02 7.743160e-03 2 23
cgcuuaUAUUGUGCCAGCUAGa
      :|: ::||||:|||:
cttcgaGTGCTGCGGTTGATTc
Features
HUGO 16011
spacer
spacer