spacer

Target Detailed View


Hit information for ENSMMUT00000012156

Gene Name CDK6
Transcript ENSMMUT00000012156
Gene ENSMMUG00000008698
Description Cell division protein kinase 6 (EC 2.7.11.22) (Serine/threonine- protein kinase PLSTIRE). [Source:Uniprot/SWISSPROT;Acc:Q00534]
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
hsa-miR-524-5p 17.6773 -17.51 2.182090e-02 2.158450e-02 2.158450e-02 465 486
cucUUUCACGAAGGGAAACAUc
   ||||||:| |::||||||
cttAAAGTGTTACTTTTTGTAa
hsa-miR-520d-5p 17.0101 -12.35 3.491160e-02 3.430920e-02 1.253780e-02 467 486
cUUUCCCGAAGGGAAACAUc
 |||| |:| |::||||||
tAAAGTGTTACTTTTTGTAa
mmu-miR-666-3p 16.9451 -16.24 4.508740e-02 4.408610e-02 7.539120e-05 351 372
ucgUCCGCUAGUGCGACGUCGG
   | |: ||| | |||||||:
atgATGTAATCTCTCTGCAGCT
hsa-miR-548a-3p 16.8405 -11.29 4.379820e-02 2.487720e-03 1.321670e-05 490 509
CGUUUUCAUUAACGGUCAAAAc
||||:|  :|||  |||||||
GCAAGAACGATT--CAGTTTTa
hsa-miR-412 16.7625 -21.69 3.055860e-02 3.009640e-02 1.821430e-03 650 673
ugcCGAUC-ACCUGGUCCACUUCA
   |||||  | |  |||||||||
tttGCTAGCAGTAAAAGGTGAAGT
hsa-miR-142-5p 16.7126 -15.43 5.013540e-02 4.889940e-02 1.186300e-02 182 202
ucaUCACGAAAGAUGAAAUAC
   |||| || | :|||||||
aagAGTGATTGCAGCTTTATG
hsa-miR-609 16.6931 -18.1 2.677140e-02 2.641620e-02 9.940770e-03 24 43
ucucuACUCUCUUUGUGGGA
     || |: :||||||||
gatccTGCGGAGAACACCCT
hsa-miR-942 16.6313 -17.58 8.391370e-02 8.048940e-02 2.914290e-02 246 267
gUGUACCGGUUUUGUCUCUUCu
 | ||  | :||: |||||||
aAAATTCCAGAAGAAGAGAAGc
hsa-miR-627 16.6313 -15.43 2.671310e-02 2.635950e-02 2.635950e-02 497 518
aggagaaaAGAAUCUCUGAGUg
        |:||| |||||||
cgattcagTTTTAAAGACTCAa
hsa-miR-872 16.6075 -17.18 3.423010e-02 3.365090e-02 2.394650e-04 343 363
gGACUUGAUUGUUCAUUGGAa
 ||||::||  | ||||:||
gCTGAGTTATGATGTAATCTc
hsa-miR-573 16.5849 -14.96 4.432410e-02 4.335610e-02 2.837450e-04 270 294
GACUAGUCAAUGUG-UAGUGAAGUc
|||| || ||:::| : ||:||||
CTGACCAATTGTGCTGCCATTTCAt
mml-miR-124a 16.5267 -20.29 3.657310e-02 3.591240e-02 3.591240e-02 1 20
aCCGUAAGUGGCGCACGGAAUU
 ||| |  :| || ||||||||
-GGCCTCAGCAGC-TGCCTTAA
hsa-miR-495 16.5267 -11.94 4.421330e-02 4.325010e-02 1.387530e-05 197 217
uucUUCACGUGGUACAAACAAA
   | || |::: |||||||||
tttATGTTCGTT-TGTTTGTTT
hsa-miR-553 16.5024 -12.03 3.747800e-02 3.678440e-02 1.974050e-03 150 170
UUUUGUUUUAGAGUGGCAAAA
||| |:  | :|:||:|||||
AAACCGCCAGTTTACTGTTTT
mmu-miR-741 16.4502 -14.24 4.745930e-02 4.635070e-02 1.509390e-04 344 366
agauguAUCUUACCGUAGAGAGu
      || :|||  |||||||
ctgagtTATGATGTAATCTCTCt
hsa-miR-660 16.3175 -23.48 2.705430e-02 2.669160e-02 1.909750e-02 310 331
guugaGGCUAUACGUUACCCAU
     || :|:|| |:||||||
tgctgCCAGTGTGGAGTGGGTA
mmu-miR-677 16.3175 -16.48 5.781280e-02 5.617340e-02 1.069760e-02 532 553
AGUCUUCGAUUAGUAGUGACUU
| | |:||   |  ||||||||
TAACAGGCATTTGTTCACTGAA
mmu-miR-466g 16.2922 -14.78 3.744020e-02 3.674800e-02 2.165360e-05 209 229
ACACACACGUACACAGACAua
||| ||| ::| |||||||
TGTTTGTTTGTTTGTCTGTtt
hsa-miR-888 16.2922 -15.9 3.876920e-02 3.802730e-02 3.802730e-02 381 400
ACUGACUGUCGAAAAACUCAU
|||:| :   | |||||||||
TGATTTGGTAC-TTTTGAGTA
mml-miR-103 16.242 -18.09 5.721330e-02 5.560740e-02 2.919790e-07 297 316
AGUAUCGGGACAUGUUACGACGa
|: || ||:||   ||||||||
TTCTAACCTTG---AATGCTGCc
hsa-miR-548a-3p 16.2129 -18.97 7.225090e-02 2.487720e-03 1.321670e-05 180 200
CGUUUUCAUUAACGGUCAAAAc
||||:|||:|||| ||| |||
GCAAGAGTGATTG-CAGCTTTa
mmu-miR-322 16.0037 -23.52 9.005850e-02 8.612230e-02 2.952030e-04 251 272
AGGUUUUGUACUUAACGACGAC
||||:|| | ||:  |||||||
TCCAGAAGAAGAGAAGCTGCTG
mml-miR-198 15.828 -19.68 8.414200e-02 8.069930e-02 5.584050e-03 113 131
ggauaaagGGGAGACCUGg
        :|:|||||||
agctgccgTCTTCTGGACa
mml-miR-107 15.8255 -18.09 8.153390e-02 7.829850e-02 1.221820e-07 297 316
acuAUCGGGACAUGUUACGACGa
   || ||:||   ||||||||
ttcTAACCTTG---AATGCTGCc
hsa-miR-193a-5p 15.7945 -19.36 9.670930e-02 9.218010e-02 8.497180e-03 496 517
aGUAGAGCGGGCGUUUCUGGGU
 |: :||  :: :||||||:||
aCGATTCAGTTTTAAAGACTCA
hsa-miR-518a-5p 15.7422 -11.84 8.235460e-02 7.905470e-02 1.256130e-02 467 486
cUUUCCCGAAGGGAAACGUc
 |||| |:| |::||||:|
tAAAGTGTTACTTTTTGTAa
mmu-miR-470 15.7214 -12.92 9.900220e-02 9.425930e-02 1.751430e-03 218 239
UGAGUGGUCACGGUCAGGUUCUU
::|:::| || ::: |:||||||
GTTTGTCTGT-TTGTTTCAAGAA
hsa-miR-409-5p 15.6173 -19.44 3.985780e-02 3.907390e-02 3.907390e-02 313 335
uacGUUUCAACGAGCCCAUUGGa
   ||: || |  :||||||:|
tgcCAGTGTGGAGTGGGTAATCc
mmu-miR-467a 15.5853 -18.22 6.942120e-02 6.706640e-02 9.519000e-03 524 544
gcgUAUAUGUACGUCCGUGAAU
   ||| |:|  ||||||:||:
tcgATAAATA-ACAGGCATTTG
hsa-miR-621 15.2411 -15.57 6.807230e-02 6.580710e-02 7.579250e-03 639 659
uccauucgcgacAACGAUCGg
            ||||||||
aaagcagtaaatTTGCTAGCa
Features
AFFY_Rhesus MmugDNA.15036.1.S1_at
AFFY_Rhesus MmugDNA.30754.1.S1_at
HUGO 1777
spacer
spacer