spacer

Target Detailed View


Hit information for ENSMMUT00000009803

Gene Name PTH
Transcript ENSMMUT00000009803
Gene ENSMMUG00000007017
Description Parathyroid hormone precursor (Parathyrin) (PTH) (Parathormone). [Source:Uniprot/SWISSPROT;Acc:P01270]
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
mml-miR-141 18.6322 -20.61 4.834710e-03 4.823040e-03 8.593440e-04 23 43
gguAGAAAUGGUCUGUCACAa
   |||   |:|||||||||
agtTCTGCTCTAGACAGTGTa
hsa-miR-518d-5p 17.9651 -16.52 9.023740e-03 8.983150e-03 1.399270e-04 16 37
GUCUUUCACGAAGGGAGAUCUc
::|  || |:| : |||||||
TGGTCAGAGTTCTGCTCTAGAc
hsa-miR-452 17.7377 -18.78 1.272770e-02 1.264700e-02 4.670920e-04 19 41
AGUC-AAAGGAGACGUUUGUCAa
||||  |||: || :|:|||||
TCAGAGTTCTGCTCTAGACAGTg
gga-miR-757 16.346 -14.79 7.068180e-02 6.824170e-02 7.491850e-03 11 30
cUUAGGGUAGACGUCGAGACG
 :|| : :|| | ||:|||||
aGATATGGTCAG-AGTTCTGC
hsa-miR-591 16.3227 -15.1 2.997020e-02 2.952550e-02 2.952550e-02 1 21
ugUUACUCUUG--GGUACCAGa
  ||||| ||:   :||||||
-aAATGAAAATAGATATGGTCa
mml-miR-103 16.1778 -13.53 6.066300e-02 5.885970e-02 2.098200e-06 42 62
aguaucgggacAUGUUACGACGa
           ||| |||||||
tagggcaacaaTAC-ATGCTGC-
mml-miR-107 16.1778 -13.53 5.931500e-02 5.759010e-02 1.897310e-06 42 62
acuaucgggacAUGUUACGACGa
           ||| |||||||
tagggcaacaaTAC-ATGCTGC-
hsa-miR-142-3p 15.7253 -16.94 7.406890e-02 7.139230e-02 1.761170e-03 33 56
aggUAUUUCAUCCU-UUGUGAUGU
   | |: |||||: |||| ||||
tagACAGTGTAGGGCAACAATACA
hsa-miR-507 15.4316 -16.92 9.716930e-02 9.259760e-02 1.046390e-02 26 46
AAGUGAGGUUUUCCACGUUUU
| ::|||:|:|  |||:|:::
TCTGCTCTAGACAGTGTAGGG
hsa-miR-626 15.3789 -9.88 9.574640e-02 9.130560e-02 2.706620e-04 22 41
UUCUGUAAAAG-UCUGUCGa
:|| : |  || ||||||:
GAGTTCTGCTCTAGACAGTg
hsa-miR-10b 15.1596 -13.43 7.897720e-02 7.897720e-02 1.281700e-03 19 43
gugUUUAAGCCAAGA--UGUCCCAU
   :|:||| | |||  |||| |||
tcaGAGTTCTGCTCTAGACAGTGTA
hsa-miR-10a 15.1596 -13.43 9.171680e-02 8.763650e-02 1.281700e-03 19 43
gugUUUAAGCCUAGA--UGUCCCAU
   :|:||| | |||  |||| |||
tcaGAGTTCTGCTCTAGACAGTGTA
mml-miR-219 14.9743 -10.29 7.273830e-02 7.015590e-02 1.516100e-04 21 42
UCUUAACGC-AAACCUGUUAgu
|||:|| :| | | ||||:|
AGAGTTCTGCTCTAGACAGTgt
Features
AFFY_Rhesus MmugDNA.23046.1.S1_at
HUGO 9606
spacer
spacer