spacer

Target Detailed View


Hit information for ENSMMUT00000007371

Gene Name LRRC61
Transcript ENSMMUT00000007371
Gene ENSMMUG00000005233
Description Leucine-rich repeat-containing protein 61. [Source:Uniprot/SWISSPROT;Acc:Q9BV99]
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
hsa-miR-519e 19.6782 -27.1 1.496230e-03 1.495110e-03 1.495110e-03 145 166
uUGUGAGAUUUUCCUCCGUGAa
 |||: ||: |||||||||||
cACATGCTGCAAGGAGGCACTg
hsa-miR-512-5p 18.1933 -27.08 1.077340e-02 1.071560e-02 5.825190e-03 333 354
CUUUCACGGGAGUUCCGACUCAC
||:|| |::  | ||||||||||
GAGAGAGTTGGC-AGGCTGAGTG
hsa-miR-515-3p 18.1728 -24.6 7.270320e-03 7.243960e-03 6.751190e-03 145 166
uUGCGAGGUUUUCUUCCGUGAg
 || : |:: |||:|||||||
cACATGCTGCAAGGAGGCACTg
hsa-miR-520f 17.5276 -22.26 1.569160e-02 2.622430e-03 2.622430e-03 145 166
uUGGGAGAUUUUCCUUCGUGAa
 || : ||: |||||:|||||
cACATGCTGCAAGGAGGCACTg
mmu-miR-763 17.42 -22.83 2.277230e-02 2.251500e-02 2.251500e-02 308 329
CGGUGACCAAGAAGGGUCGACc
||||     || |||||||||
GCCAGCCTCTCCTCCCAGCTGt
hsa-miR-638 17.396 -33.07 1.377960e-02 1.368510e-02 1.368510e-02 120 143
ucCGGCGGUGGGCGGGCGCUAGGGA
  || ||| ||: ||| :|||||||
gaGCAGCC-CCTCCCCATGATCCCT
hsa-miR-485-5p 17.3125 -24.43 4.186420e-02 4.100000e-02 3.339220e-03 296 317
cUUAAGUAGUGCCGGUCGGAGA
 ::|  : |  |||||||||||
aGGTAGGGCTGGGCCAGCCTCT
hsa-miR-940 17.1834 -29.98 4.038200e-02 3.957750e-02 3.430170e-02 375 397
ccCCUCGCCC--CCGGGACGGAA
  | ||||||    |||||||||
caGAAGCGGGACTCCCCTGCCTT
hsa-miR-516a-3p 17.1448 -19.12 3.631490e-02 2.340800e-03 3.154430e-04 146 163
UGGGAGACUUUCCUUCGU
|| : ||| |||||:|||
ACATGCTGCAAGGAGGCA
mml-miR-24 17.0975 -29.43 3.557950e-02 3.495400e-02 5.051300e-04 79 99
GACAAGGACGACUUGACUCGGU
|||  ||||| | :|||:||||
CTGGCCCTGC-GTGCTGGGCCA
mml-miR-30a-3p 17.0975 -23.79 3.228890e-02 3.177320e-02 3.177320e-02 150 170
CGACGUUUGUAGGCUGACUUUC
|||||||: |  | ||||||:|
GCTGCAAGGAGGC-ACTGAAGG
hsa-miR-767-3p 17.0161 -21.39 2.544080e-02 2.511990e-02 2.133730e-02 159 182
UCUUUGG-UACCCCAUACUCGUCU
||: ||: | |||   |||||||:
AGGCACTGAAGGGCCTTGAGCAGG
hsa-miR-565 16.9899 -26.12 3.707370e-02 3.639490e-02 3.639490e-02 292 314
UUUGUCUGUAGCG-CUCGGUCGG
|:| ||::|  || |:|||||||
AGAAAGGTAGGGCTGGGCCAGCC
rno-miR-349 16.8824 -24.01 4.200930e-02 4.113910e-02 4.113910e-02 285 306
UCUCCAAUUCUGUCGUCCCGAC
| |||  |: | :|:|||||||
ACAGGCGAGAAAGGTAGGGCTG
hsa-miR-622 16.8592 -20.62 3.645840e-02 3.580180e-02 3.089180e-02 400 420
cgagguUGGAGUCGUCUGACa
      :||||  |||||||
aaatgtGCCTCTCCAGACTGc
mml-miR-103 16.8021 -21.11 3.419080e-02 3.361290e-02 6.059630e-05 133 155
aGUA-UCGGGACAUGUUACGACGa
 ||| | ||||  || |||||||
cCATGATCCCTCCAC-ATGCTGCa
hsa-miR-668 16.8021 -26.39 2.224900e-02 2.200330e-02 1.858060e-02 336 357
caUCACCCGGCUCGGCUCACUGu
  ||| ||| | ||:|||||:|
agAGTTGGCAG-GCTGAGTGGCc
hsa-miR-150 16.7749 -19.22 3.988180e-02 3.909700e-02 1.324090e-03 315 336
gugaccauGUUCCCAACCCUCU
        ||:  |||||||||
tctcctccCAGCTGTTGGGAGA
hsa-miR-596 16.7511 -26.49 3.438700e-02 3.380250e-02 3.380250e-02 330 350
gggCUC-CUCGGCCCGUCCGAa
   ||| |||:: ||||||||
tggGAGAGAGTT-GGCAGGCTg
hsa-miR-646 16.7158 -20.88 4.369450e-02 4.275360e-02 1.589640e-03 207 226
CGGA-GUCUCCGUCGACGAa
|||| ::   |||||||||
GCCTGTGTCCGCAGCTGCTa
mml-miR-107 16.588 -19.95 4.078370e-02 3.996320e-02 7.076530e-05 136 155
ACUAUCGGGACAUGUUACGACGa
||||  ||||  || |||||||
TGAT--CCCTCCAC-ATGCTGCa
hsa-miR-574-5p 16.588 -18.34 5.809040e-02 5.643540e-02 3.433390e-03 34 55
uguGUGAGUGUGUGUGUGUGAGU
   | ||| ::| | |||||||:
ggcCTCTC-TGCCCCCACACTCG
hsa-miR-507 16.535 -17.66 3.323100e-02 3.268490e-02 3.268490e-02 169 189
aaguGAGGUUUUCCACGUUUU
    ||: |: |||||:|||:
gggcCTTGAGCAGGTGTAAAG
mmu-miR-720 16.4854 -25.53 3.290850e-02 1.101120e-03 1.101120e-03 277 295
aCCUCCGG-GGUCGCUCUa
 ||||||: | :||||||
cGGAGGCTACAGGCGAGAa
hsa-miR-502-5p 16.3188 -15.98 5.296950e-02 4.626560e-03 3.020480e-03 138 160
aucGUGGGUCUAU--CGUUCCUa
   | :||| ||:  |||||||
atcCCTCCACATGCTGCAAGGAg
hsa-miR-770-5p 16.267 -27.86 3.280000e-02 3.226790e-02 3.226790e-02 73 96
ACCGG-GACUGUGCACCAUGACCU
|||:: |||:| |   ||:||||:
TGGTTACTGGCCCTGCGTGCTGGG
mmu-miR-466c-5p 16.2372 -14.42 7.263280e-02 7.005780e-02 3.056490e-04 458 479
auacauguacGUGUGUGUGUAG
          |:: ||||||||
tgccctttctCGTCCACACATC
mmu-miR-201 16.2372 -18.73 4.255550e-02 4.166270e-02 5.665520e-03 333 354
UUCUUGUUACGGAAUGACUCAU
:|||: : || |  :||||||:
GAGAGAGTTGGCAGGCTGAGTG
hsa-miR-516b 16.2372 -18.23 7.003350e-02 2.340800e-03 3.154430e-04 261 281
UUUCACGAAGAAUGGAGGUCUa
||:|  :| ||| |||||:||
AAGGAATTACTT-CCTCCGGAg
hsa-miR-520a-5p 16.2108 -23.59 7.423000e-02 2.622430e-03 2.622430e-03 262 281
UCUUUCAUGAAGGGAGACCUC
||:|| ||||| |||| ||||
AGGAATTACTT-CCTCCGGAG
mmu-miR-685 16.2108 -20.41 4.113850e-02 1.241870e-03 1.241870e-03 82 103
cacGGAGUG-GAGUCGGUAACu
   |: |:: || :|||||||
gccCTGCGTGCTGGGCCATTGc
mmu-miR-464 16.16 -19.98 4.998000e-02 4.875160e-02 4.875160e-02 237 259
auaGAGUGUCUUAU-UUGAACCAU
   ||| |||  |: :|||||||:
ttgCTC-CAGCCTGCGACTTGGTG
hsa-miR-658 16.1231 -24.42 7.637510e-02 7.353140e-02 5.406860e-03 257 280
UGGUUGCCUGGAUGAAGGGAGGCgg
:: :| ||| :||||| ||||||
GTGGAAGGAATTACTT-CCTCCGga
mmu-miR-718 16.1027 -23.57 4.832460e-02 4.717550e-02 4.717550e-02 243 263
GCUGUGGGCCGGCCCGCCUUC
| :| : || |: ||:|||||
CAGCCTGCGACTTGGTGGAAG
mmu-miR-720 16.0458 -18.29 4.767840e-02 1.101120e-03 1.101120e-03 369 386
ACCUCCGGGGUCGCUCUa
|||| ||   ||||:||
TGGAAGCAGAAGCGGGAc
mmu-miR-685 15.9946 -26.54 5.068450e-02 1.241870e-03 1.241870e-03 310 332
caCGGAGUGGA--GUCGGUAACU
  ||||| |||  ||||::|||:
caGCCTCTCCTCCCAGCTGTTGG
hsa-miR-744 15.9146 -25.68 6.907260e-02 3.166550e-03 3.166550e-03 421 444
acGACAAUCGGGA--UCGGGGCGu
  ||||   ||:|   |||||||
caCTGTACTCCTTCCCGCCCCGCc
hsa-miR-483-5p 15.9146 -20.96 6.750740e-02 6.527920e-02 2.539970e-04 37 59
GAGGGAAGAAAG-GAGGGCAGAA
|||:|| |   | | |:||||||
CTCTCTGCCCCCACACTCGTCTT
mmu-miR-467a 15.9146 -20.29 5.066500e-02 4.940290e-02 3.619490e-03 145 167
GCGUAU-AUGUACGUCCGUGAau
| |||: |:|| | |||||||
CACATGCTGCAAGGAGGCACTga
hsa-miR-886-3p 15.8865 -21.04 4.295810e-02 4.204850e-02 1.820260e-03 187 205
UUCCCAGUCAUUCGUGGGCGC
|||| ||  | | ||||||:|
AAGGCTC--TCACCACCCGTG
hsa-miR-604 15.8418 -25.18 5.106230e-02 4.978050e-02 4.358520e-02 206 223
caGGACUUAAGGCGUCGGa
  |||| : ||||||||:
agCCTGTG-TCCGCAGCTg
mmu-miR-666-5p 15.8071 -21.98 5.928460e-02 5.756150e-02 9.439740e-04 198 219
ccGAGAGUGUCGACACGGGCGa
  | | :: : |||||:||||
caCCCGTGAGCCTGTGTCCGCa
hsa-miR-890 15.7785 -19.09 7.236180e-02 6.980570e-02 5.472320e-03 218 238
GUUGACUACGGAAAGGUUCAu
||:||| | ||  |||::||
CAGCTGCTACCACTCCGGGTt
mmu-miR-688 15.7535 -17.76 4.443690e-02 4.346400e-02 4.346400e-02 233 252
cuuauucaucagCGGACGCU
            ||||||||
cgggttgctccaGCCTGCGA
hsa-miR-744 15.6995 -25.22 8.177220e-02 3.166550e-03 3.166550e-03 67 89
acgacaAUCGG-GAUCGGGGCGU
      |:|:: ||:||||:||:
tcacccTGGTTACTGGCCCTGCG
mmu-miR-700 15.6704 -22.99 2.355970e-02 2.328430e-02 2.328430e-02 71 91
ccACCUGAGCCAAGGGCGCAC
  ||| : | |  ||:|||||
ccTGGTTACTGGCCCTGCGTG
hsa-miR-502-3p 14.8393 -23.05 9.942070e-02 4.626560e-03 3.020480e-03 167 188
acUUAGGAACGGGUCCACGUaa
  :: |||||  ||||||:|
aaGGGCCTTGAGCAGGTGTAaa
Features
AFFY_Rhesus MmugDNA.26222.1.S1_at
HUGO 21704
spacer
spacer