spacer

Target Detailed View


Hit information for ENSMMUT00000005486

Gene Name SALL4
Transcript ENSMMUT00000005486
Gene ENSMMUG00000003870
Description Sal-like protein 4 (Zinc finger protein SALL4). [Source:Uniprot/SWISSPROT;Acc:Q9UJQ4]
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
hsa-miR-524-5p 18.8747 -17.63 7.950260e-03 7.918740e-03 2.188090e-03 50 71
cUCUUUCACGAAGGGAAACAUc
 ||||  |||||: :||||||
tAGAATCTGCTTTGTTTTGTAa
hsa-miR-195 18.8608 -16.82 6.869150e-03 6.845610e-03 8.848200e-07 163 183
cGGUUAUAAAGACACGACGAu
 | | |:|| || |||||||
aCAATTGTTGCTATGCTGCTt
mml-miR-103 18.3273 -16.87 8.253480e-03 8.219510e-03 7.065200e-05 161 182
AGUAUCGGGACAUGUUACGACGA
||| | :: | |:| ||||||||
TCACAATTGT-TGCTATGCTGCT
mml-miR-15a 18.3062 -16.34 1.142930e-02 1.142930e-02 1.011590e-04 162 183
GUGUUUGGUAAU-ACACGACGAu
||| ||:::||: | |||||||
CAC-AATTGTTGCTATGCTGCTt
hsa-miR-497 17.832 -11.02 1.813650e-02 1.797300e-02 1.426280e-04 163 183
UGUUUGGUGUCACACGACGAc
|||| :  :: | |||||||
ACAATTGTTGCTATGCTGCTt
mml-miR-16 17.7377 -16.12 1.721020e-02 1.706300e-02 5.480180e-06 162 183
GCGGUUAUAAAUGCACGACGAu
| | | |:||  : |||||||
CACAATTGTTGCTATGCTGCTt
hsa-miR-508-3p 17.6485 -16.85 1.172980e-02 1.166130e-02 3.567110e-05 141 163
agaugagguUUUCCGAUGUUAGU
         ||:  |||||||||
acctcaggcAAGTCCTACAATCA
mmu-miR-322 17.624 -13.09 2.308380e-02 2.281940e-02 1.110240e-04 154 175
aGGUUUUGUACUUAACGACGAc
 |:| ||:   |||||:||||
cCTACAATCACAATTGTTGCTa
hsa-miR-448 17.624 -13.26 1.699240e-02 1.684880e-02 1.542930e-03 90 113
uacccuguAGGAUG--UAUACGUU
        ||:|||  ||||||||
tttcttttTCTTACTGATATGCAA
mml-miR-30b 17.6034 -12.35 1.422500e-02 1.422500e-02 5.896300e-04 105 125
cgacucacaUCCUACAAAUGU
         | |||||||||:
gatatgcaaATGATGTTTACG
hsa-miR-520d-5p 17.5872 -12.38 2.151410e-02 2.128430e-02 4.394200e-03 52 71
CUUUCCCGAAGGGAAACAUc
|||   ||||: :||||||
GAATCTGCTTTGTTTTGTAa
mml-miR-153 17.5872 -15.62 9.216490e-03 9.174150e-03 1.463880e-03 161 180
AGUGAAAACACUGAUACGuu
||||  |||| :||||||
TCACAATTGTTGCTATGCtg
mml-miR-30a-5p 17.5103 -12.35 1.619760e-02 1.606710e-02 5.896300e-04 104 125
gaaggucagcUCCUACAAAUGU
          | |||||||||:
tgatatgcaaATGATGTTTACG
mml-miR-33 17.4602 -12.76 1.349260e-02 1.340200e-02 5.941680e-03 15 34
gUUACGUUGAU-GUUACGUg
 |:|| ||  | |||||||
gAGTGGAAGGAGCAATGCAg
mml-miR-107 17.4222 -16.55 1.888110e-02 1.870400e-02 5.111590e-05 160 182
acuaucgggacAUGUUACGACGA
           |:| ||||||||
atcacaattgtTGCTATGCTGCT
mml-miR-15b 17.3966 -11.72 2.359810e-02 2.332180e-02 1.011590e-04 161 183
acauUUGGU-ACUACACGACGAu
    ||::: || | |||||||
tcacAATTGTTGCTATGCTGCTt
hsa-miR-632 17.3446 -19.13 2.095630e-02 2.073820e-02 6.048860e-03 19 38
agggugUCCUU-CGUCUGUG
      || || ||||||||
ggaaggAGCAATGCAGACAC
gga-miR-460 17.2829 -17.37 1.700090e-02 1.685720e-02 6.385300e-04 14 35
GUGUGUCACACAUGUUACGUCc
:: :::|   | :||||||||
TGAGTGGAAGGAGCAATGCAGa
hsa-miR-330-3p 17.196 -18.61 2.201880e-02 3.542980e-04 3.542980e-04 163 186
agagacgucCGGCAC-ACGAAACG
         ||: || ||||||||
acaattgttGCTATGCTGCTTTGC
hsa-miR-503 17.196 -19.92 1.712730e-02 1.698150e-02 7.654740e-04 159 183
gacGUCUUGACAAGG--GCGACGAu
   || ||:|||| |  :||||||
aatCACAATTGTTGCTATGCTGCTt
mmu-miR-684 17.1133 -15.69 2.713600e-02 2.677110e-02 2.677110e-02 1 13
aacugaacUUCCCUUUUGA
        ||||||:||||
------gcAAGGGAGAACT
hsa-miR-424 17.0555 -13.22 3.625390e-02 3.560460e-02 4.691790e-05 154 175
aaGUUUUGUACUUAACGACGAc
  :| ||:   |||||:||||
ccTACAATCACAATTGTTGCTa
hsa-miR-921 17.0353 -21.18 1.960710e-02 1.941610e-02 5.545870e-03 81 106
cuuAGGAC-CAAGACAGGGAGUGAUc
   |||||  |||| |::||:|||:
tccTCCTGTTTTCTTTTTCTTACTGa
hsa-miR-765 17.0319 -16.11 6.905150e-02 6.672140e-02 5.200170e-03 67 87
guaguggaaGGAAGAGGAGGu
         :| ||||||||
tgtaagaacTCATCTCCTCCt
hsa-miR-330-3p 16.9697 -14.57 2.685860e-02 3.542980e-04 3.542980e-04 46 69
AGAGACGUCCGGC-ACACGAAACG
|||||  |  |:| | ||:||||:
TCTCTAGAATCTGCTTTGTTTTGT
hsa-miR-672 16.9697 -16.35 3.939860e-02 3.863260e-02 2.232690e-04 124 146
agUGUGUGUCAUGUGGUUGGAGU
  |::  ::  ||  ||||||||
cgATGGTTGTGACCACAACCTCA
hsa-miR-600 16.8566 -13.25 2.768900e-02 2.730920e-02 8.693830e-03 51 73
cucguucCGAGAACAGACAUUCa
       |||:|  |:||||||
agaatctGCTTTGTTTTGTAAGa
hsa-miR-483-5p 16.7144 -23.07 3.311050e-02 3.256830e-02 9.914520e-04 71 92
gaggGAAGAAAGGAGGGCAGAA
    ||  | ||||||:||:||
agaaCTCATCTCCTCCTGTTTT
hsa-miR-570 16.7144 -8.13 5.903320e-02 5.732450e-02 2.310030e-02 73 94
cguuuccauuaACGACAAAAGc
           | ||||||||
aactcatctccTCCTGTTTTCt
hsa-miR-562 16.6676 -14.71 3.441560e-02 3.383010e-02 3.601420e-05 163 184
cGUUUACCAUG-U-CGAUGAAA
 ||| || |:| | |||:||||
aCAATTGTTGCTATGCTGCTTT
hsa-miR-579 16.6303 -8.3 3.976670e-02 3.898640e-02 1.389840e-02 95 118
uuagcgccaAAUAUG-GUUUACUu
         | |||: |||||||
ttttcttacTGATATGCAAATGAt
hsa-miR-586 16.6007 -12.43 5.600250e-02 5.446320e-02 4.060150e-02 14 35
cCUGGAUUUUUAUGUUACGUau
 || : :||:: :|||||||
tGAGTGGAAGGAGCAATGCAga
hsa-miR-801 16.438 -13.22 2.306500e-02 2.280100e-02 6.854070e-03 8 31
cagcuAAGGCGUGCGUCUCGUUAg
     ||  |::   :|||||||
agaacTTGAGTGGAAGGAGCAATg
hsa-miR-623 16.4041 -13.02 4.996960e-02 4.874170e-02 4.874170e-02 1 9
uggguugucggggaCGUUCCCUa
              ||||||||
--------------GCAAGGGAg
hsa-miR-518d-5p 16.3733 -17.81 4.430940e-02 1.389660e-03 6.939570e-04 32 54
GUCUUUCACG-AAGGGAGAUCUc
|||| |  |:    :|||||||
CAGACACCGTGAAATCTCTAGAa
hsa-miR-338-3p 16.3733 -13.58 5.216500e-02 5.082780e-02 5.321520e-04 158 182
GUU-GUUUUAGUGAC--UACGACcu
||| || |||:::||  ||||||
CAATCACAATTGTTGCTATGCTGct
hsa-miR-556-5p 16.2596 -13.23 4.177980e-02 4.091910e-02 1.481350e-02 60 80
GAGUAUAAUGUUACUCGAGUAG
:|::| ||::|| || ||||||
TTTGTTTTGTAA-GAACTCATC
hsa-miR-340 16.2596 -12.55 8.877520e-02 8.494870e-02 3.879140e-02 49 71
uuagUCAGA-GUAACGAAAUAUU
    | ||| | |||:|||:|||
ctagAATCTGCTTTGTTTTGTAA
hsa-miR-518a-5p 16.2078 -11.87 5.366870e-02 1.389660e-03 6.939570e-04 52 71
CUUUCCCGAAGGGAAACGUc
|||   ||||: :||||:|
GAATCTGCTTTGTTTTGTAa
hsa-miR-143 16.1174 -9.38 6.230900e-02 6.040750e-02 2.475140e-02 63 83
cucGAUGUCACGAAGUAGAGu
   :|::|     |||||||
gttTTGTAAGAACTCATCTCc
hsa-miR-657 15.9515 -15.34 6.012220e-02 5.835050e-02 4.007920e-03 38 60
GGAUCUCUCCCACUCUUGGACGG
||  || |     ||||:||||:
CCGTGAAATCTCTAGAATCTGCT
mmu-miR-669c 15.9185 -17.96 8.589500e-02 8.230940e-02 5.372100e-03 146 170
UGUGUGUAGG-UGU--GUGUUGAUA
| :|| :||| |||  |||||:|:|
AGGCAAGTCCTACAATCACAATTGT
mmu-miR-804 15.8047 -8.81 6.659530e-02 6.442630e-02 2.694410e-02 59 80
aGGUCCACUCCUUGUUGAGUGu
 :: | |  | || ||||||:
cTTTGTTTTGTAAGAACTCATc
hsa-miR-616 15.8047 -14.8 7.345980e-02 7.082650e-02 4.792910e-02 144 165
gacgaGUUUGGGAGGUUACUGa
     |||::||| |||| ||
tcaggCAAGTCCTACAATCACa
hsa-miR-876-5p 15.8047 -10.4 9.325470e-02 8.903860e-02 1.170520e-03 28 49
accacuaaGUGUUUCUUUAGGu
        ||| : ||||||:
aatgcagaCACCGTGAAATCTc
mmu-miR-673-5p 15.8047 -9.84 9.525680e-02 9.086060e-02 9.729760e-03 115 136
gagguuccUGGUCUCGACACUc
        || | :|:|||||
tgatgtttACGATGGTTGTGAc
hsa-miR-550 15.7253 -19.86 8.127770e-02 7.806240e-02 4.081080e-03 130 152
cccgagaaUGAGGGAGUCCGUga
        ||  |||||||||
ttgtgaccACAACCTCAGGCAag
hsa-miR-187 15.5773 -18.74 6.822150e-02 6.594640e-02 2.836350e-03 20 40
ggccgaCGUUGUGUUCUGUGcu
      ||||::| ||||||
gaaggaGCAATGC-AGACACcg
hsa-miR-598 15.2362 -12.71 5.205820e-02 5.072640e-02 2.799390e-03 104 121
ACUGCUACUGUUGCUACUGCAu
|||: ||| |||  ||||:||
TGAT-ATG-CAA--ATGATGTt
hsa-miR-891a 15.2362 -9.26 3.307670e-02 3.253560e-02 1.288570e-03 153 174
agucaccgAGUCCAAGCAACGu
        |||   |:|||||
tcctacaaTCACAATTGTTGCt
Features
AFFY_Rhesus MmuSTS.1771.1.S1_at
HUGO 15924
spacer
spacer