spacer

Target Detailed View


Hit information for ENSMMUT00000003205

Gene Name YTHDC1
Transcript ENSMMUT00000003205
Gene ENSMMUG00000002265
Description YTH domain-containing protein 1 (Putative splicing factor YT521). [Source:Uniprot/SWISSPROT;Acc:Q96MU7]
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
hsa-miR-603 17.3694 -13.48 1.731940e-02 1.717030e-02 1.197480e-02 273 294
cGUUUUCAUUAACGUCACACAc
 :||| ||  || :|||||||
aTAAATGTTCTTATAGTGTGTt
mmu-miR-466h 16.9534 -17.84 3.734310e-02 3.734310e-02 3.734310e-02 375 396
AUGUGUGUUCGUGUACGUGUGU
| : :||| |:|  |||||||:
TTTCTACATGTAGTTGCACACG
hsa-miR-379 16.8268 -17.26 1.551680e-02 1.539700e-02 1.539700e-02 79 99
GGAUGCAAGGUAUCAGAUGGu
::||: ||| :  |||||||
TTTATTTTCAGCTGTCTACCt
mmu-miR-470 16.5648 -22.61 4.200060e-02 4.113080e-02 8.027000e-03 228 250
ugaguggucacgGUCAGGUUCUU
            |||||||||||
ggcagaatggaaCAGTCCAAGAA
mml-miR-103 16.5648 -22.07 4.255660e-02 4.166380e-02 2.641920e-05 392 418
aGUAUCGGGACA----UGUUACGACGA
 || :|::| ||    |:|||||||||
aCACGGTTCAGTAAAAATAATGCTGCT
hsa-miR-424 16.5373 -12.3 5.613260e-02 5.458620e-02 1.156870e-02 398 419
AAGUUUUGUACUUAACGACGAc
||||: | |   | |||||||
TTCAGTAAAAATAATGCTGCTa
mmu-miR-291a-5p 16.4333 -14.27 3.559380e-02 3.559380e-02 2.658410e-02 351 372
ucucucccgGAGGUGAAACUAC
         :|:::||||||||
gccatgataTTTTGCTTTGATG
hsa-miR-429 16.4333 -21.63 3.910550e-02 3.835070e-02 3.835070e-02 445 469
UGCCAAAAUGGU---CUGUCAUAAU
|:||||| ||::   |:||||:||:
ATGGTTTGACTGTATGGCAGTGTTG
hsa-miR-374b 16.3293 -9.59 5.542330e-02 5.542330e-02 1.484310e-02 111 132
GUGAAUCGUCCAACAUAAUAUa
::: ||| ||| | ||||||:
TGTGTAGAAGGATTTATTATGa
mml-miR-107 16.2542 -18.22 5.533520e-02 5.383210e-02 1.600430e-05 396 418
acuaucgggacaUGUUACGACGA
            |:|||||||||
ggttcagtaaaaATAATGCTGCT
hsa-miR-633 16.2542 -19.49 4.536850e-02 4.435470e-02 4.435470e-02 622 644
aaAUAACACCAUCUAUGAUAAUc
  ||  ||||| |||:|||||:
agTAGCGTGGTTGATGCTATTGt
mmu-miR-322 16.2253 -11.96 7.500370e-02 7.225990e-02 1.770760e-02 398 419
AGGUUUUGUACUUAACGACGAc
|:||: | |   | |||||||
TTCAGTAAAAATAATGCTGCTa
hsa-miR-500 16.1506 -17.66 4.950830e-02 4.830270e-02 7.721880e-03 105 125
aGAGUGGGUCCAUCGUUCCUAAu
 :||| ::: |||| |||||||
gTTCA-TTGTGTAG-AAGGATTt
hsa-miR-217 16.1506 -20.22 4.318320e-02 1.100320e-03 1.100320e-03 133 157
aGGUUAGUCAAGG-AC-UACGUCAU
 ||  |: |||||  | ||||||||
cCCCCTTTGTTCCAAGCATGCAGTA
hsa-miR-628-3p 16.0952 -20.49 4.605590e-02 4.501140e-02 9.014380e-03 208 228
agcUGACGGUGAGAAUGAUCU
   |:|| ||||:|||:|:|:
tgaATTGACACTTTTATTGGG
hsa-miR-217 16.0471 -13.89 4.766080e-02 1.100320e-03 1.100320e-03 366 389
AGGUUAGUCAAGGA-CUACGUCAu
|:::||  |||:||  |||:|||
TTTGATGTGTTTCTACATGTAGTt
hsa-miR-137 16.0471 -18.57 5.089120e-02 4.961790e-02 2.281710e-03 55 77
gaUGCGCAUAAGAAUUCGUUAUU
  ::|:||:||:  |||:|:|||
nnGTGTGTGTTTACAAGTAGTAA
hsa-miR-374a 16.0173 -9.26 7.797110e-02 7.500880e-02 1.484310e-02 111 132
GUGAAUAGUCCAACAUAAUAUU
::: ||  ||| | ||||||:|
TGTGTAGAAGGATTTATTATGA
hsa-miR-487a 15.9133 -10.09 4.009470e-02 3.930150e-02 5.609030e-04 426 447
uugaccUACAGGGACAUACUAa
      ||||:   |||||||
atgcaaATGTTGAAGTATGATg
mmu-miR-291b-5p 15.9133 -12.3 5.764330e-02 5.601340e-02 2.658410e-02 351 372
ccucucccgGAGGUGAAACUAg
         :|:::|||||||
gccatgataTTTTGCTTTGATg
mmu-miR-721 15.8861 -13.03 6.319080e-02 6.123570e-02 4.302780e-02 375 395
AAGGGGGAAAAUUAACGUGac
||:|: | | ||:||||||
TTTCTACATGTAGTTGCACac
mmu-miR-696 15.8276 -21.1 4.870780e-02 4.754060e-02 4.754060e-02 377 397
GGGUGU-CGUU--CGUGUGCg
:|:||| |:|:  |||||||
TCTACATGTAGTTGCACACGg
mml-miR-16 15.8093 -15.9 8.665840e-02 8.300970e-02 2.395580e-03 397 419
gcGGUUAUAAAUG-CACGACGAU
  :||:||   |:  ||||||||
gtTCAGTAAAAATAATGCTGCTA
mml-miR-30a-5p 15.7053 -10 7.253830e-02 7.253830e-02 3.706320e-06 48 69
gaaggucagCUCCUACAAAUGU
         | | :||||||||
nnnnnnnnnGTGTGTGTTTACA
hsa-miR-498 15.633 -18.22 8.119230e-02 7.798360e-02 4.938230e-02 660 682
cUUUUUGCGGGGGACCGAACUUU
 ||  :: : | :|||||||:||
aAATTGTATACATTGGCTTGGAA
hsa-miR-630 15.6013 -18.35 8.683320e-02 8.317000e-02 3.572880e-02 217 238
UGGAAGGGACCAUGUCUUAUga
||:||: :||| :||||||:
ACTTTTATTGGGGCAGAATGga
mml-miR-200c 15.6013 -12.4 5.518260e-02 1.467690e-03 1.985790e-04 138 159
AGGUAGUAAUGGGCCGUCAUAa
|:::|:   | |  |||||||
TTTGTTCCAAGCATGCAGTATc
hsa-miR-496 15.6013 -17.09 7.016600e-02 6.776090e-02 1.641560e-02 668 688
cUCUAACCGGUACAUUAUGAGU
 | ||||||: || |||::|||
tACATTGGCT-TGGAATGTTCA
mml-miR-200c 15.6013 -15.15 5.518260e-02 1.467690e-03 1.985790e-04 447 468
agguAGUAAUGGGCCGUCAUAA
    | | |:: :||||||:||
ggttTGACTGTATGGCAGTGTT
mml-miR-30b 15.5726 -12.34 7.716980e-02 7.426740e-02 3.706320e-06 49 69
cgacucacauCCUACAAAUGU
          | :||||||||
nnnnnnnngtGTGTGTTTACA
mml-miR-101 15.4973 -17.61 7.950450e-02 7.642610e-02 2.378070e-02 449 471
GAAGUCA-AUAGUGUCAUGACAU
:|| | | ||| :||||::||||
TTTGACTGTATGGCAGTGTTGTA
hsa-miR-768-3p 15.321 -18.36 7.968820e-02 3.590950e-03 3.590950e-03 619 646
cAGUCGUCAAACUCACAGUCGUAACAcu
 ||||:||  ||: || :: :|||||
tTCAGTAGCGTGGTTGATGCTATTGTtt
hsa-miR-222 15.2591 -11.68 8.589010e-02 8.230490e-02 3.839770e-02 369 389
uggguCAUCGGUCUACAUCGA
     ||  |:| ||||||:|
gatgtGTTTCTACATGTAGTT
hsa-miR-768-3p 15.2195 -16.84 8.723740e-02 3.590950e-03 3.590950e-03 85 115
cAGUCGUCAAACUCACA-GUC--GUAACACu
 ||||| || |   | |  ||  |||||||
tTCAGCTGTCTACCTATAAAGTTCATTGTGt
hsa-miR-671-3p 15.05 -15.42 9.706730e-02 9.250510e-02 2.142270e-02 151 171
ccaccucGGGACUCUUGGCCU
       :| | |||||:|||
tgcagtaTCATAAGAACTGGA
Features
AFFY_Rhesus MmugDNA.18232.1.S1_at
AFFY_Rhesus MmugDNA.26410.1.S1_at
AFFY_Rhesus MmugDNA.42007.1.S1_at
spacer
spacer