spacer

Target Detailed View


Hit information for ENSMMUT00000002956

Gene Name TEX261
Transcript ENSMMUT00000002956
Gene ENSMMUG00000002093
Description Protein TEX261. [Source:Uniprot/SWISSPROT;Acc:Q6UWH6]
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
hsa-miR-185 18.6726 -26.26 1.182080e-02 1.175120e-02 1.175120e-02 416 438
agucCUUGACG-GAAAGAGAGGU
    ||||||:  ||||||||||
tgttGAACTGTGATTTCTCTCCA
hsa-miR-890 18.6583 -18.95 4.041720e-03 4.033560e-03 2.578520e-03 422 442
guugACUACGGAAAGGUUCAU
    |||| :|| ||||||||
actgTGATTTCTCTCCAAGTA
hsa-miR-504 17.9127 -30.45 1.471070e-02 1.460300e-02 1.460300e-02 299 322
CUAUCUC--ACGUCUGGUCCCAGA
| |:|:|   ||||: ||||||||
GCTGGGGCAGGCAGGGCAGGGTCT
hsa-miR-545 17.9127 -13.81 1.467970e-02 1.457250e-02 1.457250e-02 397 418
cgUGUGUUAUUUACAAACGACu
  ||| ||  |:| |||||||
caACAGAAATAGTTTTTGCTGt
hsa-miR-637 17.6375 -28.47 3.565540e-02 3.502720e-02 3.502720e-02 232 255
UGCGUCUCGGGCUUUCGGGGGUCa
:|  :||| |:||:| |||:|||
GCCAGGAGGCTGAGATCCCTCAGc
mml-miR-103 17.5026 -18.13 1.784080e-02 1.768260e-02 3.974550e-05 159 182
aGUAUCGGGAC-AUGUUACGACGa
 | |:||:| | | ::|||||||
gCTTGGCTCAGATCTGATGCTGCa
mmu-miR-882 17.3699 -17.64 3.179740e-02 3.129720e-02 2.946130e-03 417 438
UGAUUACGCGAUUGAGAGAGGa
::|:|  :|: | :|||||||
GTTGAACTGTGATTTCTCTCCa
mmu-miR-697 17.3489 -19.99 1.613540e-02 1.600590e-02 1.600590e-02 1 21
aGAGGUGUCCUGGUCCUACAa
 | | |:: |: ||||||||
cCCCGATGCGGGCAGGATGTg
hsa-miR-324-3p 17.3321 -25.93 3.804170e-02 3.732720e-02 1.065920e-02 291 309
GGUCGUCGUGGACCCCGUCa
|::||  :| |||||||||
CTGGC-CTAGCTGGGGCAGg
mml-miR-107 17.2865 -16.88 2.141380e-02 2.118620e-02 1.305850e-05 159 182
acuAUCGGGAC-AUGUUACGACGa
   |:||:| | | ::|||||||
gctTGGCTCAGATCTGATGCTGCa
hsa-miR-146b-5p 17.2613 -20.77 1.931540e-02 1.937220e-03 1.680670e-03 335 356
UCGGAUACCUUAAGUCAAGAGu
|||  |||| :   |||||||
AGCAGATGGTGACAAGTTCTCt
hsa-miR-615-3p 17.0442 -30.27 1.926400e-02 1.907960e-02 2.764220e-04 370 391
uUCUCCCUCUGGGUCCGAGCCu
 :|:| |:|:||  ||||:||
tGGGGAGGGGCCATGGCTTGGc
hsa-miR-146a 16.9356 -18.2 2.858300e-02 1.937220e-03 1.680670e-03 335 356
UUGGGUACCUUAAGUCAAGAGu
|:|  |||| :   |||||||
AGCAGATGGTGACAAGTTCTCt
hsa-miR-617 16.9356 -15.9 2.032490e-02 2.011970e-02 2.011970e-02 60 81
CGGUGGAAGUUUACCCUUCAGa
||||  |  ::|  |||||||
GCCAGGTGGGGACCGGAAGTCg
mmu-miR-707 16.9125 -20.31 1.487870e-02 1.476860e-02 4.647320e-03 368 388
GCAUCCGUUCGCCGUACUGAc
| |:|| |:| | ||||:||
CATGGGGAGGGGCCATGGCTt
mmu-miR-689 16.8034 -33.42 2.953290e-02 2.910110e-02 1.167960e-04 50 73
CCUGGGG---CGGCUCGCCCCUGc
||:||:|   ||| :|:||||||
GGGCCTCTATGCCAGGTGGGGACc
hsa-miR-645 16.7683 -22.93 4.086620e-02 4.004240e-02 4.004240e-02 281 300
AGUCGU-CAUGGUCGGAUCu
|||| | || |::||||||
TCAGGAGGTTCTGGCCTAGc
hsa-miR-296-3p 16.7185 -21.49 5.342410e-02 5.202210e-02 1.462670e-05 105 126
ccucucGGAGGUGGGUUGGGAg
      :|||| |:||||:||
ggctttTCTCCCCTCAACTCTg
mml-miR-15a 16.61 -13.01 4.885110e-02 4.767710e-02 4.767710e-02 400 420
GUGUUUGGUAAUACACGACGAU
|| |||: :|| | |||||:|:
CAGAAATAGTT-TTTGCTGTTG
mmu-miR-763 16.61 -29.25 4.711240e-02 4.601980e-02 4.601980e-02 281 303
cggugaCCAAGA-AGGGUCGACC
      ||||||  ||:||||||
tcaggaGGTTCTGGCCTAGCTGG
hsa-miR-195 16.5852 -12.57 4.669540e-02 4.562190e-02 4.562190e-02 401 420
cggUUAUAAAGACACGACGAU
   |||| ||:| |||||:|:
agaAATAGTTTT-TGCTGTTG
hsa-miR-769-3p 16.5302 -27.02 4.605870e-02 4.501410e-02 4.501410e-02 231 252
UUGGUUCUGGGGCCUCUAGGGuc
|:|||:||  |: ||||||||
AGCCAGGAGGCT-GAGATCCCtc
mmu-miR-434-5p 16.5014 -26.75 1.223650e-02 1.216190e-02 1.216190e-02 63 84
aCCAAGUUUGGUACUCAGCUCg
 |||  ::|||:  |||||:|
aGGTGGGGACCGGAAGTCGGGa
mmu-miR-322 16.5014 -17.53 5.960550e-02 5.786390e-02 1.348670e-02 399 420
aGGUUUUGUACUUAACGACGAC
 | :|||:|    ||||||:||
aCAGAAATAGTTTTTGCTGTTG
hsa-miR-503 16.4221 -24.01 3.404880e-02 3.347570e-02 4.331280e-03 397 420
gacGUCUUGA-CAAGGGCGACGAU
   ||||| | |||:::||||:|:
caaCAGAAATAGTTTTTGCTGTTG
hsa-miR-421 16.3141 -14.26 3.931690e-02 3.855400e-02 8.820660e-03 401 422
cgcggGUUAAUUACAGACAACUa
     :|:||  || |||||||
agaaaTAGTTTTTG-CTGTTGAa
hsa-miR-424 16.2843 -17.56 6.935950e-02 6.700880e-02 1.472420e-02 399 420
aagUUUUGUACUUAACGACGAC
   :|||:|    ||||||:||
acaGAAATAGTTTTTGCTGTTG
hsa-miR-872 16.2578 -13.57 4.859030e-02 4.742870e-02 4.742870e-02 177 197
gGACUUGAUUGUUCAUUGGAa
 ||| |  |:   |||||||
gCTGCAAGAGGCTGTAACCTc
hsa-miR-146b-3p 16.1757 -27.18 6.357460e-02 1.937220e-03 1.680670e-03 294 316
ggucUUGACUCAG-GUGUCCCGU
    |:|||:| |  :|||||||
gcctAGCTGGGGCAGGCAGGGCA
hsa-miR-662 16.1487 -27.58 3.388750e-02 3.331970e-02 2.179620e-03 3 24
GACGAC-CCGGUGUUGCACCCU
| | || || || :|:|||||:
CCGATGCGGGCAGGATGTGGGG
hsa-miR-632 15.9961 -20.28 7.149330e-02 6.899750e-02 5.258580e-04 294 312
aGGGUGUCCUUCGUCUGUg
 ||:|   |::||||:||
gCCTAGCTGGGGCAGGCAg
hsa-miR-345 15.9586 -18.85 5.745990e-02 5.584030e-02 9.582030e-03 21 44
CUCGGGACCUGAUC--CUCAGUCg
|:|  |  ||: ||  |||||||
GGGGGCAAGATCAGGAGAGTCAGg
hsa-miR-484 15.9586 -27.07 7.804830e-02 7.508020e-02 1.066920e-04 206 228
uagcCCUCCC-CUGACUCGGAcu
    |||||| |:| ||||||
ccaaGGAGGGTGGCAGAGCCTac
hsa-miR-671-3p 15.8214 -24.72 4.910970e-02 4.792330e-02 6.485550e-04 56 76
ccaccucgggACUCUUGGCCU
          ||:|:||||||
ctatgccaggTGGGGACCGGA
rno-miR-347 15.7754 -21.51 8.741330e-02 8.370170e-02 7.005970e-03 363 381
acCCGCUGGGUCUCCCUGu
  ||| |:  :|||||:|
gtGGCCATGGGGAGGGGCc
mml-miR-133a 15.7123 -20.96 7.307760e-02 7.047130e-02 6.472210e-03 9 28
ugUCGACCAACUUCCCCUGUU
  :|| || ||  ||||:|||
cgGGCAGGATG-TGGGGGCAA
hsa-miR-191 15.5578 -11.97 4.520840e-02 4.420170e-02 1.062800e-04 433 455
gucgacgaaaaCCCUAAGGCAAc
           ||  |||||||
tctccaagtacGGATTTCCGTTt
hsa-miR-192 15.494 -23.04 4.882710e-02 4.765420e-02 4.765420e-02 260 284
ccGACAGUUAAG----UAUCCAGUC
  |||||  |||    :|:||||||
ccCTGTCCCTTCCAAGGTGGGTCAG
hsa-miR-431 15.3849 -17.56 8.510690e-02 8.158590e-02 3.333840e-03 11 32
aCGUACUGC-CGGACGUUCUGu
 ||| ||:| |   ||||||:
gGCAGGATGTGGGGGCAAGATc
hsa-miR-631 15.3849 -22.44 7.828170e-02 7.529610e-02 3.021230e-03 47 68
cGACUC-CAGACCCGGUCCAga
 |||:|  |||  |||||||
cCTGGGCCTCTATGCCAGGTgg
hsa-miR-551a 15.0576 -23.24 6.973890e-02 6.973890e-02 1.842020e-02 265 284
accuuuGGUUCUCACCCAGcg
      ||||| |||||||
tcccttCCAAG-GTGGGTCag
mml-miR-215 14.9485 -18.9 7.890610e-02 7.587330e-02 5.756760e-03 260 284
caGACAGUUAAG----UAUCCAGUa
  |||||  |||    :|:|||||
ccCTGTCCCTTCCAAGGTGGGTCAg
hsa-miR-551b 14.7302 -20.89 8.749990e-02 8.378100e-02 1.842020e-02 265 284
gacuuuGGUUCAUACCCAGcg
      ||||| :||||||
tcccttCCAAG-GTGGGTCag
mmu-miR-344 14.6935 -24.19 9.531360e-02 9.091220e-02 8.265030e-03 8 33
UGUCAGUCCGAAA---CCGAUCUAGU
:|:| |||| | |   ||| ||||||
GCGGGCAGGATGTGGGGGCAAGATCA
hsa-miR-339-3p 14.5855 -19.38 7.837540e-02 7.538270e-02 2.131430e-03 136 158
gccGAGACAGCAGCUCCGCGAGU
   | |  || |:|:|| |||||
cccCACCCTCCTTGGGGGGCTCA
Features
AFFY_Rhesus MmugDNA.43250.1.S1_at
AFFY_Rhesus MmugDNA.43251.1.S1_at
HUGO 30712
spacer
spacer