spacer

Target Detailed View


Hit information for ENSMMUT00000001693

Gene Name DYNLL1
Transcript ENSMMUT00000001693
Gene ENSMMUG00000001194
Description Dynein light chain 1, cytoplasmic (Dynein light chain LC8-type 1) (8 kDa dynein light chain) (DLC8) (Protein inhibitor of neuronal nitric oxide synthase) (PIN). [Source:Uniprot/SWISSPROT;Acc:P63167]
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
mmu-miR-466d-5p 18.761 -22.78 6.644540e-03 6.644540e-03 6.644540e-03 4 23
GUACAUGUACAUGCGUGUGUGu
|||| || |||:| |||||||
CATGGAC-TGTGC-CACACACc
hsa-miR-147 18.2769 -18.58 6.336120e-03 6.336120e-03 6.336120e-03 3 22
CGUCUUCGUAAAGGUGUGUG
||| :: |  | ||||||||
GCATGGACTGTGCCACACAC
mmu-miR-883b-5p 18.0788 -17.14 1.088190e-02 1.193570e-04 1.193570e-04 226 247
acugACGAUGGGUAAGAGUCAu
    ||:|::::  |||||||
cccaTGTTGTTTTCTCTCAGTc
hsa-miR-588 18.0606 -20.02 1.062360e-02 1.056740e-02 9.956660e-04 150 170
CAAGAUUGGGUAACACCGGUu
|| |||:::::||||||::|
GTACTAGTTTGTTGTGGTTAt
mml-miR-30a-3p 17.9651 -14.97 1.339310e-02 1.330380e-02 1.009410e-02 59 82
cGACGUUUGUAG--GCUGACUUUc
 :| ||||:| |   ||||||||
aTTCCAAATACCAGAGACTGAAAt
hsa-miR-495 17.8514 -13.92 1.574380e-02 1.562050e-02 2.108110e-03 143 163
uucuucACGUGGUACAAACAAa
      ||:||:| |||||||
attctcTGTACTA-GTTTGTTg
hsa-miR-513-3p 17.7616 -12.86 1.976120e-02 1.956720e-02 5.330840e-03 64 85
ggaagaGUCUUUCCACUUUAAAu
      ||||:|  ||||||||
aaatacCAGAGA-CTGAAATTTt
hsa-miR-486-5p 17.7377 -17.59 5.961580e-03 5.943850e-03 4.721820e-05 121 141
GAGCCCCGUCGAGUCAUGUCCU
:|:|  |: |:|: |||||||:
TTTGTTGT-GTTTTGTACAGGG
hsa-miR-298 17.5639 -19.22 2.398450e-02 2.369920e-02 2.369920e-02 204 227
acccucuugGAGGGACGAAGACGa
         :||| | |||||||
tattttctaTTCCATACTTCTGCc
hsa-miR-202 17.4722 -17.31 1.266860e-02 1.258870e-02 2.198510e-03 207 224
AAGGGUACGGGAUAUGGAGA
||:|:|| ||  ||||:|||
TTTCTATTCC--ATACTTCT
mmu-miR-694 17.4602 -11.3 4.197240e-02 4.110380e-02 4.110380e-02 70 88
gaaguccGUUGUAAAAGUC
       ::| ||||||||
cagagacTGAAATTTTCAG
hsa-miR-498 17.4222 -15.75 1.456730e-02 1.446170e-02 1.446170e-02 97 119
cUUUUUGCGGGGGACCGAACUUu
 :::||| ||:|   |:|||||
aGGGAACACCTCGATGTTTGAAc
hsa-miR-548a-5p 17.3966 -8.97 4.639010e-02 4.639010e-02 2.563940e-03 189 210
ccauUUUGAGCGUUAAUGAAAa
    | |:|:|:| |||:|||
gcctACATTTGTATTTATTTTc
hsa-miR-455-3p 17.3748 -17.46 1.491670e-02 1.480600e-02 1.480600e-02 1 13
cacauauacggGUACCUGACG
           |||||||||:
--------aagCATGGACTGT
hsa-miR-365 17.2829 -10.46 6.947890e-03 6.923810e-03 6.923810e-03 124 146
UAUUCCUAAAAAU-CCCCGUAAu
:| : | ||| ||  |||||||
GTTGTGTTTTGTACAGGGCATTc
mmu-miR-883a-5p 17.2829 -19.23 2.400090e-02 1.193570e-04 1.193570e-04 225 247
cauugACGAU-GAAGAGAGUCGu
     ||:|: :|||||||||:
gcccaTGTTGTTTTCTCTCAGTc
hsa-miR-570 17.2829 -10.37 3.883750e-02 3.809300e-02 3.809300e-02 219 240
cguuuccauuaACGACAAAAGc
           ||:|||||||
acttctgcccaTGTTGTTTTCt
hsa-miR-548b-5p 17.1692 -7.04 5.939470e-02 5.939470e-02 2.563940e-03 189 210
CCGGUUUUGGUGUUAAUGAAAa
| |:| | ::::| |||:|||
GCCTACATTTGTATTTATTTTc
hsa-miR-542-3p 17.1692 -11.36 2.649490e-02 2.614700e-02 2.614700e-02 254 275
AAAGUCAAUAGUUAGACAGUGU
||| |   || |||||||::||
TTTAAAAAATAAATCTGTTGCA
hsa-miR-381 17.1692 -13.84 2.393190e-02 2.364780e-02 3.577650e-04 181 203
UGUC-UCUCGAACGGGAACAUAu
:||| | ||| | | :||||||
GCAGAATAGCCTACATTTGTATt
hsa-miR-623 17.0828 -23.25 2.758600e-02 2.720900e-02 1.783990e-03 80 102
uggguuGUCGGGGACGUUCCCUa
      |||||::  :||||||
aattttCAGCCTTGCTAAGGGAa
mml-miR-188 17.0555 -20.21 2.289990e-02 2.263970e-02 1.443620e-02 81 103
UGGGAGGUGGUACG-UUCCCUac
|:::|| :|| ||| ||||||
ATTTTCAGCCTTGCTAAGGGAac
hsa-miR-559 17.0319 -6.36 5.818590e-02 5.652550e-02 6.748560e-04 190 210
aaaaccACGUAUAAAUGAAAu
      | ::||||||:|||
cctacaTTTGTATTTATTTTc
hsa-miR-490-5p 17.0124 -17.12 1.343940e-02 1.334950e-02 9.666060e-03 17 36
UGGGUGGACCUCUAGGUAcc
|| ||||  | |||||||
ACACACCCAGTGATCCATcc
mml-miR-182 16.9418 -12.7 2.636340e-02 2.601890e-02 3.507910e-05 77 98
ACACUCAAGAUGGUAACGGUUU
||  | ||: | | ||||:||:
TGAAATTTTCAGCCTTGCTAAG
hsa-miR-548c-5p 16.9418 -7.68 6.334580e-02 6.334580e-02 2.563940e-03 189 210
CCGUUUUUGGCGUUAAUGAAAa
| | | | ::|:| |||:|||
GCCTACATTTGTATTTATTTTc
hsa-miR-146b-3p 16.9418 -19.51 3.362830e-02 3.306920e-02 3.949540e-04 122 143
ggucuugacucAGGUGUCCCGU
           | :||||||||
ttgttgtgtttTGTACAGGGCA
hsa-miR-300 16.9418 -9.19 2.554900e-02 2.522540e-02 1.242920e-03 183 203
UCUCUCUCAGACGGGAACAUAu
||| | || || | :||||||
AGA-ATAGCCTACATTTGTATt
hsa-miR-877 16.8975 -16.68 3.948860e-02 3.871910e-02 9.812470e-03 239 258
GGGACGCGGUAGAGGAGAUg
|:||  |:|  :||||:||
CTCTCAGTCCATTCCTTTAa
hsa-miR-644 16.8821 -13.69 2.609580e-02 2.575820e-02 7.039300e-03 3 21
CGAGAUUCUUUCGGUGUGa
|| : :|  : |||||||
GCATGGACTGTGCCACACa
hsa-miR-532-5p 16.8281 -16.96 1.940450e-02 1.921740e-02 1.921740e-02 124 145
UGCCAGGAUGUGAGUUCCGUAc
:: || :| ::: ||:|||||
GTTGTGTTTTGTACAGGGCATt
mml-miR-19a 16.7435 -10.98 3.424460e-02 2.889890e-03 2.889890e-03 116 138
agucaAAACGUAUCUAAACGUGU
     ||||:   | ||||:|||
gaaccTTTGTTGTGTTTTGTACA
mml-miR-19b 16.7435 -12.1 2.946690e-02 2.889890e-03 2.889890e-03 116 138
agucaAAACGUACCUAAACGUGU
     ||||:   | ||||:|||
gaaccTTTGTTGTGTTTTGTACA
mmu-miR-717 16.7144 -14.46 2.810400e-02 2.771280e-02 5.337770e-03 97 118
UCUCUUCCAUAGAGACAGACUc
||:|||    ||  |||:|||
AGGGAACACCTCGATGTTTGAa
hsa-miR-561 16.7144 -7.33 5.849510e-02 5.681710e-02 1.441500e-02 65 86
UGAAGUUCCUAGAAUUUGAAAc
| | | || : || |||:|||
AATACCAGAGACTGAAATTTTc
hsa-miR-424 16.7144 -9.46 4.836980e-02 4.721860e-02 1.072290e-02 254 276
AAGUUUUGUACUUA-ACGACGac
||:|||| || ||| ||:|||
TTTAAAAAATAAATCTGTTGCag
mmu-miR-682 16.6889 -18.35 3.037290e-02 2.991630e-02 2.093040e-03 33 53
gucugaagUGACACUGACGUC
        ||   ||||||||
atccaaaaACAAGGACTGCAG
hsa-miR-645 16.6508 -18.47 4.529980e-02 4.428910e-02 5.413700e-03 178 195
AGUCGUCAUGGUCGGAUcu
|:||||| | :||||||
TTAGCAG-AATAGCCTAca
hsa-miR-593 16.6508 -15.33 6.864260e-02 6.633970e-02 1.670070e-02 59 77
ucuuugggGUCGUCUCUGu
        :| |||||||
attccaaaTACCAGAGACt
hsa-miR-548d-5p 16.6007 -5.12 9.598510e-02 9.152240e-02 2.563940e-03 189 210
CCGUUUUUGGUGUUAAUGAAAa
| | | | ::::| |||:|||
GCCTACATTTGTATTTATTTTc
hsa-miR-874 16.6007 -19.3 4.769840e-02 4.657870e-02 1.519850e-02 122 144
AGCCA-GGGAGCCCGGUCCCGUc
|:| | : :|: |  |||||||
TTGTTGTGTTTTGTACAGGGCAt
mml-miR-19a 16.5172 -11.3 4.151390e-02 2.889890e-03 2.889890e-03 181 203
aGUCAAAACGUAUCUAAACGUGu
 |||  | || || |||||:|:
gCAGAATAGCCTACATTTGTATt
mmu-miR-666-3p 16.487 -19.11 6.545260e-02 6.335660e-02 3.567540e-03 34 55
ucguccgcuagugcGACGUCGG
              ||||||||
tccaaaaacaaggaCTGCAGCC
mmu-miR-466b-5p 16.487 -21.76 5.700840e-02 5.700840e-02 1.609700e-02 4 23
GUACAUGUACAUGUGUGUGUag
|||| || |||:| ||||||
CATGGAC-TGTGC-CACACAcc
hsa-miR-595 16.4603 -13.02 3.774920e-02 3.704560e-02 9.666230e-03 203 223
ucUGUGUGGUGCCGUGUGAAG
  |: : |:|:  ||:|||||
ttATTTTCTATTCCATACTTC
hsa-miR-633 16.4041 -17.84 4.016650e-02 3.937050e-02 3.937050e-02 157 181
AAAUAACACC-AU-CUAUGAUAAUC
|||:|||||| ||  | || |||||
TTTGTTGTGGTTATAAAACAATTAG
hsa-miR-208b 16.3733 -16.93 2.271990e-02 2.246370e-02 4.717830e-03 114 135
uGUUUGGAAAACAAGCAGAAUA
 ::|||||||  | :||:||:|
tTGAACCTTTGTTGTGTTTTGT
mmu-miR-322 16.3733 -9.22 6.632950e-02 6.417750e-02 1.625800e-02 254 276
AGGUUUUGUACUUA-ACGACGac
|::|||| || ||| ||:|||
TTTAAAAAATAAATCTGTTGCag
mml-miR-103 16.2909 -17.14 5.471060e-02 5.324090e-02 6.008650e-05 215 236
aGUAUCGGGACAUGUUACGACGA
 |||| ::|||  | |||:||:|
cCATACTTCTG-CCCATGTTGTT
mmu-miR-883a-3p 16.2596 -17.26 3.525220e-02 1.193570e-04 1.193570e-04 150 169
UAUGACUCUCGACAACGUCAAU
:|||| ||  :|||||::||||
GTACT-AG-TTTGTTGTGGTTA
hsa-miR-675 16.1778 -27.71 3.775740e-02 3.705350e-02 4.682880e-03 133 155
gugacaCCCGGGAGAGGCGUGGU
      |||| :||||:|:||:|
tgtacaGGGCATTCTCTGTACTA
hsa-miR-154 16.1459 -13.08 4.208920e-02 4.121570e-02 4.121570e-02 173 193
gcuuccGUUGUGCCUAUUGGAU
      :|:|| | |||:||||
aacaatTAGCA-GAATAGCCTA
mml-miR-17-3p 16.0929 -14.71 6.549700e-02 6.339810e-02 6.457550e-04 35 54
uguucacggaagUGACGUCa
            |||||||
ccaaaaacaaggACTGCAGc
hsa-miR-604 16.0727 -17.87 4.127380e-02 4.043360e-02 8.709990e-03 38 56
caggacUUAAGGCGUCGGA
      |:  |:|||||||
aaaacaAGGACTGCAGCCT
hsa-miR-609 15.9779 -13.32 5.899750e-02 5.729090e-02 6.809580e-04 89 108
ucucuacUCUCUUUGUGGGa
       | :|:||||||:
ccttgctAAGGGAACACCTc
mmu-miR-713 15.957 -12.66 4.599120e-02 4.494960e-02 4.494960e-02 231 249
CGACACACGGAAGUCACGU
|:||| | |: ||||| ||
GTTGTTTTCTCTCAGTCCA
mmu-miR-466a-5p 15.9185 -17.54 9.489400e-02 9.053070e-02 1.609700e-02 4 23
aUACAUGUACAUGUGUGUGUau
 ||| || |||:| ||||||
cATGGAC-TGTGC-CACACAcc
hsa-miR-545 15.9185 -9.85 8.181420e-02 3.816260e-03 3.816260e-03 143 164
cguGUGUUAUUUACAAACGACu
   | | :||   |||||:||
attCTCTGTACTAGTTTGTTGt
mmu-miR-466e-5p 15.9185 -19.66 9.263000e-02 9.053070e-02 1.609700e-02 4 23
aUACAUGUACAUGUGUGUGUag
 ||| || |||:| ||||||
cATGGAC-TGTGC-CACACAcc
mmu-miR-669a 15.9185 -24.37 8.136870e-02 7.814630e-02 1.221650e-02 3 24
UGUACUUG-UACGUGUGUGUUGa
:||||:|| :||| |||||| |
GCATGGACTGTGC-CACACACCc
hsa-miR-638 15.9145 -30.97 5.304150e-02 5.165930e-02 2.668690e-03 9 34
uccgGCGGUGGGCGGG-CGCUAGGga
    :||||| | ||| |:|||||
actgTGCCACACACCCAGTGATCCat
hsa-miR-647 15.8888 -15.32 7.320690e-02 7.059150e-02 1.590420e-02 38 57
cUUCCUUCACUCACGUCGGug
 ||  ||| || |||||||
aAAACAAG-GACTGCAGCCta
hsa-miR-140-3p 15.8888 -13.35 6.140290e-02 5.955570e-02 3.546890e-03 148 168
GGCACCAAGAUGGGACACCAu
|:||  |  | : :||||||
CTGTACTAGTTTGTTGTGGTt
hsa-miR-330-3p 15.8384 -15.26 7.173450e-02 6.922200e-02 9.907000e-03 113 135
agagacguccggcACACGAAACG
             ||||:||||:
tttgaacctttgtTGTGTTTTGT
hsa-miR-545 15.8047 -10.93 9.001520e-02 3.816260e-03 3.816260e-03 107 128
cguguguuAUUUACAAACGACu
        |:||  ||||:||
tcgatgttTGAACCTTTGTTGt
hsa-miR-1 15.8047 -12.68 9.993530e-02 9.510400e-02 1.011900e-02 195 217
UAUGUAUGAA-GAAAUGUAAGGU
|| ::||:|| :||| :||||||
ATTTGTATTTATTTTCTATTCCA
hsa-miR-138 15.7253 -21.42 9.524810e-02 9.085270e-02 1.802790e-02 51 74
GCCGGA-CUAAGUGUUGUGGUCga
| ||||  ||||  ||:|||||
CAGCCTAAATTCCAAATACCAGag
mml-miR-107 15.7253 -13.64 8.919170e-02 8.532980e-02 3.335240e-04 215 236
acUAUCGGGACAUGUUACGACGA
  ||| ::|||  | |||:||:|
ccATACTTCTG-CCCATGTTGTT
mmu-miR-883b-3p 15.691 -16.53 6.462710e-02 1.193570e-04 1.193570e-04 150 169
UAUGACUCUCUACAACGUCAAU
:|||| ||   |||||::||||
GTACT-AG-TTTGTTGTGGTTA
mmu-miR-292-5p 15.691 -17.18 6.876910e-02 6.645780e-02 1.289550e-02 95 119
GUUUUCUCG-GGGGU--CAAACUca
:||::|| | ||:|:  ||||||
TAAGGGAACACCTCGATGTTTGAac
hsa-miR-520f 15.691 -11.77 9.957710e-02 9.477980e-02 1.666630e-02 29 50
UUGGGAGAUUUUCCUUCGUGAa
| || || ||||  ||| |||
ATCCATCCAAAAACAAGGACTg
mml-miR-19b 15.6121 -9.99 7.802130e-02 2.889890e-03 2.889890e-03 181 203
aGUCAAAACGUACCUAAACGUGu
 |||  | || |  |||||:|:
gCAGAATAGCCTACATTTGTATt
mmu-miR-679 15.4636 -22.62 9.373140e-02 8.947270e-02 1.741550e-02 226 248
uGGUUC-UCAGUGGAGUGUCAGG
 ||| |  ||: :||| ||||||
cCCATGTTGTTTTCTCTCAGTCC
mml-miR-96 15.4636 -12.48 8.730750e-02 8.360470e-02 2.312380e-03 1 19
cgUUUUUACACGAUCACGGUuu
  ||: |||  || ||||||
--AAGCATGGACT-GTGCCAca
hsa-miR-758 15.4636 -11.37 6.003810e-02 5.827130e-02 4.710980e-02 151 173
ccaAUCACCUGGU-CCAGUGUUU
   ||||  :::: |||:|:|||
tacTAGTTTGTTGTGGTTATAAA
hsa-miR-410 15.4316 -10.14 7.702010e-02 4.001410e-03 4.001410e-03 111 131
uguccggUAGACACAAUAUAA
       | || ||||:|:||
tgtttgaACCTTTGTTGTGTT
hsa-miR-371-5p 15.2882 -13.59 9.658680e-02 9.206890e-02 8.476680e-03 100 119
ucacgGGGGUGUCAAACUca
     ||:|:  ||||||
gaacaCCTCGATGTTTGAac
mmu-miR-883a-3p 15.2362 -15.17 9.153390e-02 1.193570e-04 1.193570e-04 258 279
uaugacUCUCGACAACGUCAAU
      | | ||||||||| |:
aaaaatAAATCTGTTGCAGATG
hsa-miR-95 15.2362 -11.55 6.260350e-02 6.068420e-02 3.011500e-04 252 275
acGAGUUAUUUA--UGGGCAACuu
  :|:|| ||||  |:|:||||
ccTTTAAAAAATAAATCTGTTGca
hsa-miR-410 15.2029 -8.16 9.224080e-02 4.001410e-03 4.001410e-03 153 173
uGUCCGGUAGACACAAUAUaa
 :|| :::|:   ||||||
cTAGTTTGTTGTGGTTATAaa
mmu-miR-701 15.0886 -11.94 5.519040e-02 5.369500e-02 7.749440e-03 147 170
AGGUA-GAUAAAGU--CGCCGAUu
||::| ||| ||::  |:||:||
TCTGTACTAGTTTGTTGTGGTTAt
hsa-miR-891a 14.8951 -11.42 4.596550e-02 1.270060e-03 1.270060e-03 144 165
agucacCGAGUCCAAGCAACGU
      |: |  |||:||||::
ttctctGTACTAGTTTGTTGTG
hsa-miR-891a 14.7814 -8.72 5.126650e-02 1.270060e-03 1.270060e-03 107 129
AGUCACCGA-GUCCAAGCAACGU
||: || :|  |  ||:||||::
TCGATGTTTGAACCTTTGTTGTG
mmu-miR-715 14.6314 -11.85 7.197720e-02 6.944790e-02 4.823010e-03 1 10
gugcgcccccacaCGUGCCUc
             |||:|||
-----------aaGCATGGAc
Features
AFFY_Rhesus MmugDNA.2252.1.S1_at
HUGO 15476
spacer
spacer