spacer

Target Detailed View


Hit information for ENSGACT00000025500

Gene Name DDX5 (2 of 2)
Transcript ENSGACT00000025500
Gene ENSGACG00000019254
Description Probable ATP-dependent RNA helicase DDX5 (EC 3.6.1.-) (DEAD box protein 5) (RNA helicase p68). [Source:Uniprot/SWISSPROT;Acc:P17844]
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
xtr-miR-367 18.0788 -13.35 1.442930e-02 1.432570e-02 5.734890e-03 149 170
agUGGUAACGAUGUCACGUUAA
  || | | :  :|||||||||
agACAAGTCTCCTAGTGCAATT
fru-miR-210 17.7377 -15.89 1.757030e-02 1.741680e-02 1.732800e-03 1 17
aaucggcgACAGUGUGCGUGUc
        || :|:|||||||
-----ataTGATATACGCACAa
dre-miR-363 17.2829 -11.83 2.394780e-02 2.366330e-02 2.366330e-02 148 170
AUGUCUACCUAUGG-CACGUUAA
|| | | |  | |: ||||||||
TAGACAAGTCTCCTAGTGCAATT
dre-miR-93 17.1692 -13.62 5.262430e-02 5.126360e-02 1.158670e-04 164 187
AUGGACGUGUU--UGUCGUGAAAA
|:|   :|::|  :| ||||||||
TGCAATTATGACTGCTGCACTTTT
fru-miR-144 17.0124 -15.29 5.571860e-02 5.419480e-02 2.116640e-04 62 81
UCAUGUAGUAGAUAUGACAu
:|| :||:||:| ||||||
GGTTTATTATTTTTACTGTt
dre-miR-733 16.9697 -16.31 2.995940e-02 2.951510e-02 4.244270e-03 112 134
uUGGUGACUCGAUUUGGUUGCGU
 |:||:| ||: || |||| |||
tATCATTTAGTAAACCCAAAGCA
fru-miR-92 16.8281 -13.39 2.720000e-02 2.683340e-02 2.683340e-02 151 170
UGUCCGGCCCUGUUCACGUUAu
||| |:|    | ||||||||
ACAAGTC--TCCTAGTGCAATt
fru-miR-25 16.7144 -14.47 3.891450e-02 3.816710e-02 3.816710e-02 149 170
agucuggcucuGUUCACGUUAc
           | ||||||||
agacaagtctcCTAGTGCAATt
xtr-miR-106 16.5506 -16.44 8.562160e-02 8.205850e-02 3.692560e-04 159 187
aGAUGGACGUGAUAUU-----CGUGAAAA
 ||| :   |:|||:|     ||||||||
cCTAGTGCAATTATGACTGCTGCACTTTT
dre-miR-728 16.487 -8.8 3.241270e-02 3.189300e-02 3.189300e-02 102 124
CUUUUGCAUCACA-UGAAUCAUa
| |::  |:|| | |:||||||
GCAGGGTTGGTATCATTTAGTAa
dre-miR-155 16.487 -12.23 4.758130e-02 4.646710e-02 4.646710e-02 117 138
ggggauagugcuaaUCGUAAUU
              ||||||||
tttagtaaacccaaAGCATTAA
fru-miR-183 16.4041 -14.58 4.444190e-02 4.346880e-02 4.346880e-02 148 170
GUCACUUAAGAUGGUCACGGUAu
:||  || ||| |:||||| ||
TAGACAAGTCTCCTAGTGCAATt
fru-miR-1 16.3733 -11.36 9.222770e-02 8.810250e-02 9.718380e-07 187 209
uAUGUAUGAAG-AAAUGUAAGGu
 | | |::||:    |||||||
tTCCTTGTTTTGGGAACATTCCt
fru-miR-17 16.1459 -13.67 9.637240e-02 9.187420e-02 1.156220e-03 167 187
auggacgUGACAUUCGUGAAAc
       ||||   |||||||
aattatgACTG-CTGCACTTTt
fru-miR-10b 16.0647 -12.46 3.127590e-02 3.127590e-02 3.127590e-02 86 109
guguuuAAGCCAA-GAUGUCCCAu
      ||:| || | :||||||
ttttgcTTTGCTTACAGCAGGGTt
dre-miR-461 16.0322 -17.33 8.243800e-02 7.913150e-02 5.955490e-04 31 52
aaccguAAAUCGGGUAAGGACU
      |||:|:::| ||||||
catgatTTTGGTTTAGTCCTGA
fru-miR-18 16.0322 -13.67 8.271810e-02 7.938940e-02 9.370150e-06 167 187
aUAGACGUGAUCUACGUGGAAu
 ||:   ||| | |||||:||
aATTATGACT-GCTGCACTTTt
fru-miR-10d 15.9145 -13.49 4.046220e-02 3.965450e-02 3.965450e-02 84 109
guguguguAAGCCAA-GAUGUCCCAu
        ||:| || | :||||||
acttttgcTTTGCTTACAGCAGGGTt
dre-miR-736 15.7745 -12.11 7.744440e-02 7.452150e-02 1.871100e-02 179 199
uuuUGAAAAACAAGCAGAAUg
   |||||||  |:||:||:
tgcACTTTTTCCTTGTTTTGg
fru-miR-182 15.4316 -12.72 7.408900e-02 7.141100e-02 6.174930e-03 9 29
aucaaccguucAGAUCUUGGU
           | |:||||||
tacgcacaataTATGGAACCA
dre-miR-738 14.9333 -17.17 8.191840e-02 7.865290e-02 9.351370e-03 130 151
cUCCAGGGCUGCGCCCGGCAUCg
 ||  ::  |:| | |:|||||
aAGCATTAAATG-GAGTCGTAGa
Features
HUGO 2746
spacer
spacer