spacer

Target Detailed View


Hit information for ENSGACT00000024964

Gene Name NP_065930.2
Transcript ENSGACT00000024964
Gene ENSGACG00000018843
Description CDNA FLJ31980 fis, clone NT2RP7008487, weakly similar to TRICHOHYALIN. [Source:Uniprot/SPTREMBL;Acc:Q96MS1]
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
fru-miR-338 17.6237 -18.11 1.966150e-02 1.946950e-02 7.410320e-03 441 462
guuguuuuAGUGACUACGACCU
        |:|| |||||||||
attattttTTACAGATGCTGGA
dre-miR-461 17.0864 -17.5 3.240850e-02 3.188900e-02 3.188900e-02 73 94
aaccgUAAAUCGGGUAAGGACu
     ||||: |:||||:|||
cagtgATTTGACTCATTTCTGt
fru-miR-1 17.0864 -16.82 4.995560e-02 4.872830e-02 4.071700e-05 459 480
uaugUAUGAAGAAAUGUAAGGu
    |||:||||  ||||||:
tggaATATTTCTGCACATTCTt
fru-miR-181a 17.0052 -16.39 5.637780e-02 5.481800e-02 1.300110e-03 20 40
UGAGUGGCUGUCGCAACUUACAA
|||||:: ||  | |||:|||||
ACTCATTAAC--CTTTGGATGTT
fru-miR-30b 16.5491 -11.49 6.133980e-02 5.949640e-02 6.015480e-03 284 305
ucgacucacAUCCUACAAAUGU
         |||  ||||||||
taccggcaaTAGCTTGTTTACA
fru-miR-30c 16.5491 -17.53 5.821470e-02 5.821470e-02 6.015480e-03 284 305
ggcucucacAUCCUACAAAUGU
         |||  ||||||||
taccggcaaTAGCTTGTTTACA
dre-miR-206 16.4416 -15.82 8.779850e-02 8.405460e-02 7.026080e-06 459 480
ggugUGUGAAGGAAUGUAAGGu
    |:|:|||:  ||||||:
tggaATATTTCTGCACATTCTt
fru-miR-202 16.3342 -18.05 5.664700e-02 5.507240e-02 2.702450e-03 102 122
AAAAGGGUACGGGAUACGGAGa
||||:::|| || |:||:|||
TTTTTTTAT-CCATGTGTCTCc
Features
RefSeq_peptide NP_065930
spacer
spacer