spacer

Target Detailed View


Hit information for ENSGACT00000022514

Gene Name E2F5
Transcript ENSGACT00000022514
Gene ENSGACG00000017016
Description Transcription factor E2F5 (E2F-5). [Source:Uniprot/SWISSPROT;Acc:Q15329]
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
fru-miR-1 18.0535 -18.2 2.140950e-02 2.118190e-02 1.245210e-05 477 499
UAUGUAUGAAGA-AAUGUAAGGU
:|: ||::|||| |||||||:|:
GTGAATGTTTCTGTTACATTTCG
fru-miR-194 17.9282 -16.57 1.353850e-02 2.109870e-03 2.109870e-03 473 494
gGUGUACCU-CAACGACAAUGU
 || :|| | ||| ||||||||
aCAAGTGAATGTTTCTGTTACA
fru-miR-124 17.0864 -25.09 2.864580e-02 2.823940e-02 1.591920e-04 2 23
aaccGUAAGUGGCGCACGGAAu
    | | |:||||||||:||
gcctCCTCCGCCGCGTGCTTTt
dre-miR-206 16.8715 -16.99 6.026370e-02 5.848380e-02 3.892200e-04 477 499
gGUGUGUGAAGG-AAUGUAAGGU
 :: |:::|||: |||||||:|:
gTGAATGTTTCTGTTACATTTCG
dre-miR-34b 16.7913 -22.41 5.216670e-02 5.216670e-02 1.284050e-05 247 269
gUUAGUCGAUUGUUGUGACGGAu
 :| :|   ||||:|:||||||
aGACTATACAACAGCGCTGCCTt
fru-let-7d 16.5491 -23.83 6.357980e-02 6.357980e-02 1.641500e-07 248 270
UUGGUAUGUUGGU-UGAUGGAGu
:||:||||||| : :||:|||:
GACTATACAACAGCGCTGCCTTc
dre-miR-34c 16.4704 -19.52 6.930830e-02 6.696100e-02 1.284050e-05 246 268
CAUUAGUUGAUUGACGUGACGGA
| :| :|   ||| ||:||||||
GAGACTATACAACAGCGCTGCCT
dre-miR-93 16.4416 -15.62 9.622540e-02 9.174070e-02 2.455530e-05 188 209
auggacGUGUUUGUCGUGAAAA
      | |  || ||||||||
ttcagcCTCCTACTGCACTTTT
fru-miR-181b 16.4416 -11.88 9.730760e-02 9.272310e-02 1.733110e-06 464 485
ggguggcuGUCGUUACUUACAA
        :|  |:||||||||
taatatttTACAAGTGAATGTT
fru-let-7a 16.3342 -24.53 7.468530e-02 7.468530e-02 1.641500e-07 248 270
UUGAUAUGUUG-GAUGAUGGAGu
:||||||||||   :||:|||:
GACTATACAACAGCGCTGCCTTc
fru-let-7g 16.3342 -21.16 7.356800e-02 7.356800e-02 1.641500e-07 248 270
UUGAUAUGUU-UGAUGAUGGAGu
:||||||||| |  :||:|||:
GACTATACAACAGCGCTGCCTTc
fru-miR-122 16.2267 -19.45 8.689350e-02 8.322530e-02 7.612740e-03 478 499
GUUUGUGGUAACAGUGUGAGGU
::||::::  |||:|||:|:|:
TGAATGTTTCTGTTACATTTCG
fru-miR-10d 16.1128 -24.85 3.378970e-02 3.378970e-02 3.378970e-02 109 134
gugugUGUA-AGCCAAGAUGUCCCAU
     |::| ||||||:||| |||||
ttccaATGTCTCGGTTTTACCGGGTA
fru-miR-194 16.0922 -12.48 6.640950e-02 2.109870e-03 2.109870e-03 67 87
gguguaccucAACGACAAUGU
          || |||||||:
acttcccccaTTTCTGTTACG
fru-miR-10b 16.0426 -23.82 3.191540e-02 3.191540e-02 3.191540e-02 112 134
guguuuaAGCCAAGAUGUCCCAU
       ||||||:||| |||||
caatgtcTCGGTTTTACCGGGTA
fru-let-7j 16.0118 -16.7 8.836100e-02 8.456970e-02 1.641500e-07 248 270
UUGACAUGUU-UUUUGAUGGAGu
:||| ||||| |: :||:|||:
GACTATACAACAGCGCTGCCTTc
fru-miR-26 16.0118 -17.42 7.578920e-02 7.298840e-02 5.327310e-03 428 452
UCGGAUAGG--ACCUA-AUGAACUU
| || ||:|  |||:| ||:||||:
ACCCAATTCAATGGGTATATTTGAG
fru-miR-135b 15.9043 -11.05 9.666580e-02 9.214060e-02 9.295080e-03 443 463
GUCUAUCCUUAUUUUUCGGUAu
:| ||  ||: :|||||:|||
TATATTTGAG-GAAAAGTCATc
fru-miR-135a 15.9043 -13.67 8.648990e-02 8.648990e-02 9.295080e-03 443 463
GUGUAUCCUUAUCUUUCGGUAu
:|:||  ||: | ||||:|||
TATATTTGAGGA-AAAGTCATc
fru-miR-219 15.5819 -10.72 6.889690e-02 6.657710e-02 7.806490e-03 83 104
uucuuaacgcaaacCUGUUAGU
              ||||||||
ttacgcacactgctGACAATCA
Features
HUGO 3119
spacer
spacer