spacer

Target Detailed View


Hit information for ENSGACT00000022330

Gene Name TLR3
Transcript ENSGACT00000022330
Gene ENSGACG00000016874
Description Toll-like receptor 3 precursor (CD283 antigen). [Source:Uniprot/SWISSPROT;Acc:O15455]
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
fru-miR-130 20.8793 -24.86 1.954070e-03 1.952160e-03 1.952160e-03 84 105
uACGGGAAAAUUAUAACGUGAc
 |||||| | |||||||||||
tTGCCCTCTGAATATTGCACTc
fru-miR-18 18.1174 -18.76 1.251270e-02 1.243470e-02 1.243470e-02 126 149
AUAGACGUG-AUCU-ACGUGGAAU
| | ||||: || | |||||||||
TTTATGCATATAAATTGCACCTTA
dre-miR-454b 17.8965 -18.14 2.239420e-02 2.239420e-02 4.888940e-03 87 105
GGGAUAUUCGUUAUAACGUGAu
|||| |:   |||||||||||
CCCTCTG---AATATTGCACTc
dre-miR-454a 17.6756 -19.99 2.668380e-02 2.633090e-02 4.888940e-03 84 105
gggauaaucgUUAUAACGUGAu
          |||||||||||
ttgccctctgAATATTGCACTc
fru-miR-144 17.4171 -10.62 4.055560e-02 3.140930e-03 1.669390e-04 245 263
ucAUGUAGUAGAUAUGACAu
  | :||::| ||||||||
taTTTATTGT-TATACTGTt
fru-miR-144 16.5239 -13.31 8.143150e-02 3.140930e-03 1.669390e-04 280 298
ucaUGUAGUAGAUAUGACAu
   | |||||| |||:|||
taaAAATCATC-ATATTGTc
fru-miR-375 16.4604 -19.05 4.898830e-02 4.780770e-02 4.780770e-02 160 182
aUUGCGCUCGGC-UUGCUUGUUU
 ||:|: ||: | ||:||||:||
gAATGTAAGTGGTAATGAACGAA
fru-miR-1 16.4604 -14.36 8.564310e-02 8.207820e-02 1.016940e-05 363 384
UAUGUAUGAAGAAAUGUAAGGU
|||:| ||||||| |||| |::
ATATACACTTCTTAACATACTG
dre-miR-499 16.0185 -9.05 9.327120e-02 8.905360e-02 1.120100e-03 110 130
AUUUGUAGUGACGUUCAGAAUu
||:|:|| :|  : |||:|||
TAGATAT-GCCCTCAGTTTTAt
fru-miR-101b 16.0185 -9.76 8.142670e-02 3.354010e-03 3.354010e-03 242 263
GAAGUCAAUAGUAUCAUGACAu
|| :| ||||::|  ||||||
CTATATTTATTGTTATACTGTt
fru-miR-101a 16.0185 -13.16 8.422620e-02 3.354010e-03 3.354010e-03 254 274
GAAGUCAAUAGUGUCAUGACAU
:| :| |  ||| ||||:|||:
TTATACTGTTCA-AGTATTGTG
dre-miR-363 15.908 -12.15 7.719280e-02 7.428860e-02 4.099840e-04 20 41
auGUCUACCUAUGGCACGUUAa
  :|||   : |::|||:|||
atTAGAAATGAATTGTGTAATa
fru-miR-219 15.7975 -4.15 5.619090e-02 5.464140e-02 1.111470e-03 324 345
UUCUUAACGCAAACCUGUUAGu
|| |:|| | ||| || ||||
AACAGTTACATTTTGAAAATCc
dre-miR-150 15.6871 -17.31 5.063470e-02 4.937410e-02 2.597330e-03 257 277
GUGACCAUGUUCCUAACCCUCu
:||| || |||| |||| |||
TACT-GTTCAAGTATTGTGAGt
fru-miR-182 15.6571 -12.13 5.949470e-02 5.775950e-02 1.926950e-04 136 155
AUCAACCGUUCAGAUCUUGGU
||  | |||  | |||||:||
TAAATTGCACCT-TAGAATCA
Features
HUGO 11849
spacer
spacer