spacer

Target Detailed View


Hit information for ENSGACT00000022251

Gene Name TRIM2
Transcript ENSGACT00000022251
Gene ENSGACG00000016815
Description Tripartite motif-containing protein 2 (RING finger protein 86). [Source:Uniprot/SWISSPROT;Acc:Q9C040]
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
dre-miR-206 18.6157 -20.95 1.263810e-02 1.255860e-02 2.001280e-05 186 207
GGUGUGUGAAGGAAUGUAAGGU
:||||  ||  || ||||||||
TCACAACCTCGCTCACATTCCA
fru-miR-210 17.7499 -24.31 1.738440e-02 8.023910e-04 8.023910e-04 1 23
aaucGGCGACAG-UGUGCGUGUc
    :| ||||| :||||||||
ccccTCTCTGTCGGCACGCACAc
fru-miR-22a 17.2087 -23.32 1.876410e-02 1.876410e-02 2.741300e-04 407 428
uGUCAAGAAGUCGACCGUCGAA
 :|||||    |  ||||||||
cTAGTTCCAGTGACGGCAGCTT
dre-miR-139 17.1482 -18.64 3.283150e-02 3.229840e-02 3.229840e-02 460 477
ucUGUGUACGUGACAUCU
  |:| |  ||||||||:
taATAGACACACTGTAGG
dre-miR-740 17.1005 -14.32 9.966240e-02 9.485710e-02 8.997860e-03 245 270
UGACAUG-GUAUGGU---GAAAAAUa
::||||| :||:::|   |||||||
GTTGTACATATGTTAGACCTTTTTAg
fru-miR-1 16.9922 -14.21 5.420790e-02 5.276480e-02 2.851990e-05 186 207
uaUGUAUGAAGAAAUGUAAGGU
  |||  ||   | ||||||||
tcACAACCTCGCTCACATTCCA
fru-miR-210 16.7758 -22.54 4.060470e-02 8.023910e-04 8.023910e-04 40 61
aaucggcgacaGUGUGCGUGUc
           ||||||||||
acacaaacgcaCACACGCACAc
fru-miR-194 16.7519 -13.9 3.769910e-02 3.699730e-02 3.699730e-02 417 437
ggUGUACCUCAACGACAAUGU
  ||:   : || ||||||||
tgACGGCAGCTTCCTGTTACA
fru-miR-22b 16.5593 -21.63 3.795140e-02 3.724030e-02 2.741300e-04 407 428
uGUCGAGAAGUUGACCGUCGAA
 :||:||    :  ||||||||
cTAGTTCCAGTGACGGCAGCTT
fru-miR-122 16.4511 -20.62 7.002600e-02 6.763040e-02 4.573870e-03 185 207
guuUGUGGUAAC-AGUGUGAGGU
   ||| | | | |||||:||||
ttcACAACCTCGCTCACATTCCA
fru-miR-222 16.4048 -17.34 4.068190e-02 3.986550e-02 3.986550e-02 262 286
cucuGGGUCAUCGGU-CUACAUCGa
    :::||| ||:: |||||:||
ccttTTTAGTTGCTGTGATGTGGCa
Features
HUGO 15974
spacer
spacer