spacer

Target Detailed View


Hit information for ENSGACT00000020961

Gene Name CCPG1
Transcript ENSGACT00000020961
Gene ENSGACG00000015850
Description Dyslexia susceptibility 1 candidate gene 1 protein. [Source:Uniprot/SWISSPROT;Acc:Q8WXU2]
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
fru-miR-1 19.269 -22.17 7.298240e-03 7.271670e-03 3.798860e-05 426 446
UAUGUAUGAAGAAAUGUAAGGU
||:||| |||| | ||||||||
ATGCATTCTTC-TAACATTCCA
dre-miR-206 18.6231 -19.08 1.255350e-02 1.247500e-02 6.940210e-05 424 446
ggUGUGUGA-AGGAAUGUAAGGU
  |::||:| |:|| ||||||||
agATGCATTCTTCTAACATTCCA
dre-miR-736 17.7432 -16.22 1.379600e-02 1.370130e-02 1.370130e-02 471 491
uUUUGAAAAACAAGCAGAAUG
 :||: |||||||:||:|||:
tGAATGTTTTGTTTGTTTTAT
fru-miR-19b 17.5702 -17.82 2.878210e-02 1.922190e-03 5.669480e-06 473 498
aguCAAAACGUAC---CUAAACGUGU
   ||||||: ||    |||||||||
aatGTTTTGTTTGTTTTATTTGCACA
dre-miR-737 17.5268 -8.12 3.507500e-02 3.446700e-02 3.446700e-02 10 30
aUAAAAGAAAUCCAAAACUAA
 | |  :|| | |||||||||
cACTGATTTAATGTTTTGATT
fru-miR-19a 17.2488 -16.42 4.157160e-02 1.922190e-03 5.669480e-06 473 498
aguCAAAACGUAU---CUAAACGUGU
   ||||||: |:    |||||||||
aatGTTTTGTTTGTTTTATTTGCACA
fru-miR-122 16.9008 -14.16 4.520980e-02 4.420310e-02 3.744380e-03 425 446
gUUUGUGGUAACAGUGUGAGGU
 | :||:: || | |||:||||
gATGCATTCTTCTAACATTCCA
fru-miR-19a 16.7131 -11.34 6.332220e-02 1.922190e-03 5.669480e-06 51 73
agucaaaacgUAUCUAAACGUGU
          :|| :||||||||
ccnnnnnnnnGTAAGTTTGCACA
fru-miR-137 16.3625 -7.37 5.079200e-02 4.952370e-02 4.952370e-02 257 277
AUGCGCAUAAGAAUUCGUUAUu
|:: | ||  :|| |||||||
TGTACCTACATTT-AGCAATAc
fru-miR-30d 15.9319 -10.1 9.191470e-02 8.781700e-02 6.757370e-05 354 375
GAAGGUCAGCCCCUACAAAUGU
:| :::| :| |  ||||||:|
TTCTTGGATGCGTTTGTTTATA
dre-miR-451 15.609 -11.11 6.732120e-02 6.510510e-02 7.720170e-03 92 113
uugagucauuaccaUUGCCAAA
              ||||||||
actgaacctccttgAACGGTTT
Features
HUGO 24227
spacer
spacer