spacer

Target Detailed View


Hit information for ENSGACT00000020837

Gene Name CRHBP (1 of 2)
Transcript ENSGACT00000020837
Gene ENSGACG00000015759
Description Corticotropin-releasing factor-binding protein precursor (CRF-binding protein) (CRF-BP) (Corticotropin-releasing hormone-binding protein) (CRH-BP). [Source:Uniprot/SWISSPROT;Acc:P24387]
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
xtr-miR-208 17.746 -16.67 1.351810e-02 1.342710e-02 6.664400e-03 243 264
UGUUCGAAAUACGAGCAGAAUa
|||: :  |:|  ||||||||
ACAGATGCTGTTGTCGTCTTAc
dre-miR-736 17.6159 -17.33 1.544370e-02 1.532510e-02 1.532510e-02 244 264
uUUUGAAAAACAAGCAGAAUG
 |:|:  | |  |||||||||
cAGATGCTGTTGTCGTCTTAC
fru-miR-1 17.4153 -15.48 3.750230e-02 3.680780e-02 5.602510e-05 261 283
uAUGUAUG-AAGAAAUGUAAGGu
 |||:||| |  |  |||||||
tTACGTACATGATCAACATTCCt
fru-miR-27e 17.1949 -15.4 4.265160e-02 4.175480e-02 4.175480e-02 214 235
GUGACUUGAAUCGGUGACACUU
:|:||   ||: :::|||||||
TATTGTTGTTGTTTGCTGTGAA
dre-miR-723 17.1111 -13.85 3.338470e-02 3.283360e-02 3.283360e-02 44 65
ucguGUCUAAAUUAACUACAGAA
    | |||| :|  ||||||||
ccgtCTGATTGGA-CGATGTCTT
fru-miR-210 17.0847 -24.68 3.106290e-02 3.058540e-02 4.508110e-05 249 270
aauCGGCGACAGUGUGCGUGUc
   |::|: ||| :|||:|||
gctGTTGTCGTCTTACGTACAt
dre-miR-206 16.9745 -18.51 5.502600e-02 5.353950e-02 5.567720e-04 261 283
GGUGUGUGAAGGA-AUGUAAGGu
::||::|| |  |  |||||||
TTACGTACATGATCAACATTCCt
fru-miR-107 16.6723 -16.91 5.751530e-02 5.589260e-02 1.443180e-04 232 254
ACUAUCGGGACAUGU-UACGACGA
||| || |:  |||| ||||||:|
TGA-AGACTCCTACAGATGCTGTT
fru-miR-15a 16.5336 -22.13 8.792120e-02 8.416700e-02 2.122640e-04 152 175
guguuuGGUAAGGC--ACGACGAU
      ||:|||:|  ||:|||||
ttgttcCCGTTCTGATTGTTGCTA
fru-miR-103 16.4529 -16.1 7.209260e-02 6.955530e-02 2.019410e-04 231 254
aGUAUCGGGACAUGU-UACGACGA
 :: || |:  |||| ||||||:|
gTGAAGACTCCTACAGATGCTGTT
fru-miR-217 16.4233 -15.04 4.815030e-02 4.700950e-02 1.777530e-05 341 363
gguuaGUCAAGG-ACUACGUCAu
     || | || | |||||||
gagtcCATTGCCGTTATGCAGTt
xtr-miR-367 16.0927 -17.25 7.865410e-02 7.564040e-02 2.547240e-03 348 368
AGUGGUAACGAUGUCACGUUAA
|::||:||  |:|||| |||||
TTGCCGTT-ATGCAGTTCAATT
fru-miR-101b 15.8722 -12.34 9.146140e-02 8.740350e-02 8.410520e-04 199 220
gaAGUCAAUAGUAUCAUGACAu
  |::|| :   |:|||:|||
tgTTGGTGGAATTGGTATTGTt
fru-miR-153a 15.5415 -10.79 9.580450e-02 9.135840e-02 9.024190e-04 340 361
cuagugaaAACACUGAUACGUU
        |||  ::||||||:
agagtccaTTGCCGTTATGCAG
fru-miR-153b 15.5415 -10.51 9.399140e-02 9.135840e-02 9.024190e-04 340 361
cgaguaaaAACACUGAUACGUU
        |||  ::||||||:
agagtccaTTGCCGTTATGCAG
Features
HUGO 2356
spacer
spacer