spacer

Target Detailed View


Hit information for ENSGACT00000019320

Gene Name PEPD
Transcript ENSGACT00000019320
Gene ENSGACG00000014582
Description Xaa-Pro dipeptidase (EC 3.4.13.9) (X-Pro dipeptidase) (Proline dipeptidase) (Prolidase) (Imidodipeptidase). [Source:Uniprot/SWISSPROT;Acc:P12955]
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
dre-miR-206 17.624 -17.18 3.086130e-02 3.039000e-02 2.668900e-04 136 156
GGUGUGUGAAGGAAUGUAAGGU
:::|||| || :| |||||:|:
TTGCACA-TTGTTAACATTTCG
fru-miR-429 17.3966 -15.14 2.675940e-02 2.640450e-02 7.239970e-03 61 81
UGCCGUAAUGGUCUGUCAUAAu
|||| |  || |  |||||||
ACGG-AACACAAATCAGTATTt
fru-miR-1 17.1692 -11.4 4.648580e-02 4.542190e-02 3.965760e-05 136 156
uAUGUAUGAAGAAAUGUAAGGU
 |:|| | || || |||||:|:
tTGCACA-TTGTTAACATTTCG
fru-miR-203 16.9418 -12.05 7.169380e-02 6.918410e-02 4.421890e-05 136 157
guucaccAGGAUUUGUAAAGUG
       |: | ||||||||:|
ttgcacaTTGTTAACATTTCGC
dre-miR-454a 16.8281 -12.29 5.354770e-02 5.354770e-02 6.526510e-03 123 143
GGGAUAAUCGUUAUAACGUGau
|: |||| |: ||:||||||
CTATATTCGT-ATGTTGCACat
fru-miR-200b 16.6007 -11.25 5.142950e-02 5.012940e-02 2.512960e-03 60 81
aguaguaaUGGUCCGUCAUAAu
        || |  |||||||
aacggaacACAAATCAGTATTt
dre-miR-454b 16.6007 -16.83 6.571580e-02 6.360310e-02 6.526510e-03 121 143
ggGAUAUUCGU-UAUAACGUGau
  |||||  |: ||:||||||
aaCTATATTCGTATGTTGCACat
Features
HUGO 8840
spacer
spacer