spacer

Target Detailed View


Hit information for ENSGACT00000019080

Gene Name MMD
Transcript ENSGACT00000019080
Gene ENSGACG00000014433
Description Monocyte to macrophage differentiation protein (Progestin and adipoQ receptor family member XI). [Source:Uniprot/SWISSPROT;Acc:Q15546]
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
fru-miR-1 18.2826 -12.92 1.749120e-02 1.733910e-02 4.405860e-05 220 241
uAUGUAUGAAGAAAUGUAAGGU
 |::||  ||: | ||||||||
tTGTATCGTTTGTCACATTCCA
fru-miR-132 17.958 -18.59 1.137340e-02 1.130900e-02 1.130900e-02 60 81
gCUGGUACCGACAUCUGACAAu
 ||: ||| | |||||:||||
aGATAATGACCGTAGATTGTTt
fru-miR-212 17.9401 -20.34 1.351040e-02 1.341950e-02 1.341950e-02 61 81
ucggUACUGACAUCUGACAAu
    ||||| |||||:||||
gataATGACCGTAGATTGTTt
dre-miR-206 17.8498 -14.57 2.520300e-02 2.488810e-02 5.558820e-04 220 241
GGUGUGUGAAGGAAUGUAAGGU
::::|:  ||: | ||||||||
TTGTATCGTTTGTCACATTCCA
fru-miR-122 17.7417 -26.68 1.972320e-02 1.953000e-02 1.953000e-02 219 241
guuUGUGGU-AACAGUGUGAGGU
   ::|:|: ||||||||:||||
tttGTATCGTTTGTCACATTCCA
fru-miR-30b 17.6335 -14.69 2.561470e-02 2.561470e-02 4.451950e-08 63 84
ucgACUCACAUCCUACAAAUGu
   |||  ||||  |||||||
taaTGACCGTAGATTGTTTACt
fru-miR-30c 17.0926 -13.31 3.749800e-02 3.680370e-02 4.451950e-08 63 84
ggcuCUCACAUCCUACAAAUGu
    ||  ||||  |||||||
taatGACCGTAGATTGTTTACt
fru-miR-24 17.0926 -27.2 2.663900e-02 2.628730e-02 3.080640e-03 28 51
GACAAGGACG-AC-UUGACUCGGU
| |  :|||| || |:|||||||:
CAGCGTCTGCGTGCAGCTGAGCCG
fru-miR-9 16.6878 -16.14 7.199230e-02 6.946190e-02 3.435050e-04 402 424
AGUAUGUCGAUCUAUUGGUUUCU
|||| :    | : ||||||||:
TCATTTTCAAAAGAAACCAAAGG
Features
HUGO 7153
spacer
spacer