spacer

Target Detailed View


Hit information for ENSGACT00000018142

Gene Name PHF12
Transcript ENSGACT00000018142
Gene ENSGACG00000013703
Description PHD finger protein 12 (PHD factor 1) (Pf1). [Source:Uniprot/SWISSPROT;Acc:Q96QT6]
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
fru-miR-18 17.6663 -18.25 1.891640e-02 1.873860e-02 8.123120e-03 26 46
aUAGACGUGAUCUACGUGGAAu
 :|:||: || | ||||||||
aGTTTGT-CTTGTTGCACCTTc
fru-miR-19b 17.5816 -14.56 2.852120e-02 3.661280e-03 5.433670e-09 329 350
AGUCAAAACGUACCUAAACGUGu
|:  |||||| ||  |||||||
TTTCTTTTGC-TGCTTTTGCACc
dre-miR-457b 17.3412 -12.67 4.016520e-02 4.016520e-02 1.032850e-02 323 343
GAGGUCAUAAAUACACGACGAA
:||:| | ||  | ||||||||
TTCTACT-TTCTTTTGCTGCTT
fru-miR-19a 17.258 -13.24 4.127100e-02 3.661280e-03 5.433670e-09 329 350
AGUCAAAACGUAUCUAAACGUGu
|:  |||||| |:  |||||||
TTTCTTTTGC-TGCTTTTGCACc
fru-miR-29b 17.2328 -15.31 2.215860e-02 2.215860e-02 2.215860e-02 237 258
UGUGACUAAAGUUUACCACGAU
|:| ||:|  :: ||||||:||
ATAATGGTCATGTATGGTGTTA
dre-miR-206 17.016 -15.69 5.304020e-02 5.165810e-02 9.180740e-06 306 327
ggugugUGAAGGAAUGUAAGGU
      | |||| |||||||:|
gtaatgAATTCCATACATTCTA
dre-miR-457a 16.7992 -10.89 6.273460e-02 6.080730e-02 1.032850e-02 323 343
ACGGUUAUAACUACACGACGAA
| |:| | ||  | ||||||||
TTCTACT-TTCTTTTGCTGCTT
dre-miR-739 16.5576 -20.36 3.148600e-02 3.099550e-02 3.099550e-02 214 234
uUGGGAAGAGGUGAAGCCGGa
 :|:|  ||:: |||:||||
tGCTCGACTTTTCTTTGGCCa
fru-miR-16 16.4741 -11.85 8.344460e-02 8.005790e-02 1.139810e-02 323 343
GAGGUUAUAAAUGCACGACGAu
:||:| | ||  : |||||||
TTCTACT-TTCTTTTGCTGCTt
fru-miR-15a 16.4741 -13.62 9.192350e-02 8.782510e-02 1.343050e-02 322 343
guguuUGGUAAGGCACGACGAu
     ||: | :: |||||||
attctACTTTCTTTTGCTGCTt
fru-miR-1 16.4741 -11.8 8.464680e-02 8.116320e-02 5.116980e-06 306 327
UAUGUAUGAAGAAAUGUAAGGU
:||   | |||  |||||||:|
GTAATGAATTCCATACATTCTA
fru-miR-19a 16.2872 -10.97 8.811300e-02 3.661280e-03 5.433670e-09 98 120
AGUCAAAACGUAUCUAAACGUGU
|:| |  | :|||  ||||||::
TTAATAGTTTATATCTTTGCATG
fru-miR-29a 16.2573 -15.67 4.710170e-02 4.600960e-02 4.600960e-02 238 258
AUUGGCUAAAGUUUACCACGAU
||| :|:|  :: ||||||:||
TAA-TGGTCATGTATGGTGTTA
fru-miR-219 16.0406 -8.36 4.458760e-02 4.360820e-02 2.796090e-04 124 144
uuCUUAACGCAAACCUGUUAGu
  ||| | : | | |||||||
ttGAAGTAT-TATTGACAATCt
fru-miR-205 15.9322 -15.43 8.345220e-02 8.006490e-02 1.779180e-03 42 63
gucugaggccaccUUACUUCCU
             ||||||||:
ccttcctagtcacAATGAAGGG
fru-miR-22b 15.607 -16.99 8.334830e-02 7.996940e-02 2.627400e-04 337 361
UGUCGAGAA-GU--UGACCGUCGAa
:| |||:|| ||  |: ||:||||
GCTGCTTTTGCACCATAGGTAGCTa
Features
HUGO 20816
spacer
spacer