spacer

Target Detailed View


Hit information for ENSGACT00000016872

Gene Name MEOX2
Transcript ENSGACT00000016872
Gene ENSGACG00000012753
Description Homeobox protein MOX-2 (Mesenchyme homeobox 2) (Growth arrest-specific homeobox). [Source:Uniprot/SWISSPROT;Acc:P50222]
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
fru-miR-152 17.7894 -16.69 1.991030e-02 1.971340e-02 8.894630e-09 365 386
uguUUCAAGACAAUACGUGACu
   |:| |:|| | |||||||
agcAGGCTTTGATTTGCACTGt
fru-miR-130 17.2503 -17.13 3.841640e-02 3.768780e-02 9.183470e-09 365 385
uacgggaAAAUUAUAACGUGAC
       |||:|| ||||||||
agcaggcTTTGAT-TTGCACTG
fru-miR-19a 17.0607 -16.62 4.821690e-02 4.707290e-02 3.987270e-03 362 384
agucaaaaCGUAUCUAAACGUGu
        || | |||||||||
aaaagcagGCTTTGATTTGCACt
fru-miR-19b 17.0607 -15.92 4.322710e-02 4.322710e-02 3.987270e-03 362 384
agucaaaaCGUACCUAAACGUGu
        || | |||||||||
aaaagcagGCTTTGATTTGCACt
fru-miR-202 17.0347 -22.28 2.986430e-02 2.942280e-02 2.942280e-02 338 359
aaaAGGGUACGGGAUACGGAGa
   |:||| |:: |:||||||
acaTTCCACGTTGTGTGCCTCg
fru-miR-216a 17.0347 -14.84 2.880850e-02 2.839750e-02 2.839750e-02 248 269
agUGUCAACGGUCGACUCUAAA
  ||: ||| ||  ||||:|||
aaACGATTGACATGTGAGGTTT
dre-miR-456 17.0347 -23.58 3.437040e-02 3.378640e-02 3.378640e-02 28 48
aCUGUUGGUAGAUUGGUCGGAc
 ||||: |  ||: |||||||
gGACAGGC-CCTGCCCAGCCTt
fru-miR-148 16.9269 -16.69 4.443180e-02 4.345920e-02 1.830460e-07 365 386
uguUUCAAGACAUUACGUGACu
   |:| |:||   |||||||
agcAGGCTTTGATTTGCACTGt
dre-miR-206 16.7112 -14.36 6.938350e-02 6.703120e-02 2.697320e-07 324 345
GGUGUGUGAAGGAAUGUAAGGU
:|: :|  || :  ||||||||
TCGAGCTGTTGTAAACATTCCA
fru-miR-1 16.28 -13.9 9.981060e-02 9.499120e-02 3.623000e-08 324 345
uauguaugAAGAAAUGUAAGGU
        || |  ||||||||
tcgagctgTTGTAAACATTCCA
dre-miR-146a 15.8804 -17.6 7.756300e-02 7.463130e-02 5.569830e-03 257 280
gGUAGAUACC-UUAAGUCAAGAGu
 ||| |: ||   ||::||||||
aCATGTGAGGTTTTTTGGTTCTCc
dre-miR-732 15.7409 -16.51 9.205570e-02 8.794570e-02 8.621490e-04 356 377
uGGCUCUCAAGAGACGAAACUc
 :|||||       |||||||
cTCGAGAAAAGCAGGCTTTGAt
Features
HUGO 7014
spacer
spacer