spacer

Target Detailed View


Hit information for ENSGACT00000009367

Gene Name DDX5 (1 of 2)
Transcript ENSGACT00000009367
Gene ENSGACG00000007026
Description Probable ATP-dependent RNA helicase DDX5 (EC 3.6.1.-) (DEAD box protein 5) (RNA helicase p68). [Source:Uniprot/SWISSPROT;Acc:P17844]
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
fru-miR-1 19.8981 -12.5 4.172620e-03 4.163930e-03 2.848630e-06 182 203
uAUGUAUGAAGAAAUGUAAGGu
 ||: || ||: |||||||||
cTATTTAATTTGTTACATTCCc
dre-miR-206 19.7844 -14.93 4.383510e-03 4.373920e-03 1.784940e-05 182 203
GGUGUGUGAAGGAAUGUAAGGu
|:|: :| ||: |||||||||
CTATTTAATTTGTTACATTCCc
fru-miR-101b 18.4199 -8.98 1.146350e-02 1.146350e-02 1.146350e-02 70 91
GAAGUCAAUAGUAUCAUGACAU
:||:| || |: | |||:||||
TTTTATTTCTTTTTGTATTGTA
dre-miR-740 18.0788 -11.75 5.049890e-02 1.232950e-03 1.232950e-03 115 134
uGACAUGGUAUGGUGAAAAAUa
 || ||||| :|  |||||||
cCTCTACCAAGC--CTTTTTAa
dre-miR-740 18.0788 -10.99 5.049890e-02 1.232950e-03 1.232950e-03 64 85
UGACAUGGUAUGGUGAAAAAUA
||||  :: ||:: ||||||:|
ACTGATTTTTATTTCTTTTTGT
fru-miR-101a 18.0788 -8.98 1.559750e-02 1.547650e-02 1.547650e-02 70 91
GAAGUCAAUAGUGUCAUGACAU
:||:| || |: : |||:||||
TTTTATTTCTTTTTGTATTGTA
fru-miR-184 17.4891 -18.52 1.949110e-02 1.930240e-02 8.246330e-03 25 45
ggGAAUAGUCAAGAGGCAGGU
  :||||:: ||:|::||||:
aaTTTATTGCTTTTTTGTCCG
fru-miR-152 17.0555 -20.92 3.729520e-02 3.660830e-02 1.960410e-03 215 236
uguuUCAAGACAAUACGUGAcu
    ||||||||| ||:|||
gtttAGTTCTGTTTTGTACTag
fru-miR-122 17.0555 -16.08 3.884490e-02 3.810010e-02 1.698590e-04 182 203
guuugugguAACAGUGUGAGGu
         ||||:|||:|||
ctatttaatTTGTTACATTCCc
dre-miR-462 16.8281 -13.69 2.742270e-02 2.705010e-02 3.877550e-03 206 228
UCGACGUAAU-ACCCAAGGCAAu
||| |:| |: |  ||||:|||
AGCAGTAATGTTTAGTTCTGTTt
fru-miR-130 16.6007 -14.45 6.479570e-02 4.059240e-03 3.103980e-05 73 94
uacGGGAAAAUUAUAACGUGac
   ::||||| :|||||:||
tatTTCTTTTTGTATTGTACac
fru-miR-10d 16.587 -17.2 2.191210e-02 2.191210e-02 1.112890e-02 79 103
guguGUGUAAGCCAAGAUGUCCCAu
    :::|||     | |||||||
ttttTGTATTGTACACAACAGGGTt
fru-let-7e 16.487 -21.27 6.005370e-02 5.828600e-02 3.397260e-03 180 201
UUGAUAAGUUAGAUGAUGGAGu
|||||||:|||:|::||| |:
AACTATTTAATTTGTTACATTc
xtr-miR-33a 16.4196 -15.03 8.405030e-02 8.061500e-02 8.681480e-03 130 148
guuacgUUGAUGUUACGUg
      | ||:||:||||
tttaagATCTGCAGTGCAa
fru-miR-19b 16.4041 -10.24 7.259160e-02 7.259160e-02 1.563140e-03 212 234
aguCAAAACGUACCUAAACGUGu
   |||| |:   | ||||:||
aatGTTTAGTTCTGTTTTGTACt
fru-miR-19a 16.4041 -10.24 8.051640e-02 7.736020e-02 1.563140e-03 212 234
aguCAAAACGUAUCUAAACGUGu
   |||| |:   | ||||:||
aatGTTTAGTTCTGTTTTGTACt
fru-miR-10b 16.1778 -14.57 2.818890e-02 2.818890e-02 1.112890e-02 81 103
guGUUUAAGCCAAGAUGUCCCAu
  :: |||     | |||||||
ttTGTATTGTACACAACAGGGTt
dre-miR-454a 16.1459 -12.09 9.289690e-02 8.871260e-02 1.039800e-02 212 235
gggauAAUC--GUUAUAACGUGAU
     ||||  | :| |||:||||
aatgtTTAGTTCTGTTTTGTACTA
fru-miR-130 16.1459 -10.47 9.292610e-02 4.059240e-03 3.103980e-05 213 235
UACGGG-AAAAUUAUAACGUGAc
|||:::  ||  :| |||:|||
ATGTTTAGTTCTGTTTTGTACTa
fru-miR-148 16.1459 -20.68 8.504090e-02 8.152530e-02 8.867190e-03 215 236
uguuUCAAGACAUUACGUGAcu
    ||||||||  ||:|||
gtttAGTTCTGTTTTGTACTag
fru-miR-10c 16.1459 -12.53 3.344930e-02 3.289610e-02 1.112890e-02 82 103
uguuuaggccuaGAUGUCCCAu
            | |||||||
ttgtattgtacaCAACAGGGTt
dre-miR-146a 15.9515 -11.64 7.297230e-02 7.037340e-02 8.279460e-03 204 226
gGUAGAUACCUUAAGUCAAGAgu
 || | :|   :||:||||||
gCAGCAGTAATGTTTAGTTCTgt
dre-miR-141 15.8047 -16.19 9.601160e-02 9.154650e-02 8.380770e-03 140 159
CGUAGCAAUGGUCUGUCACAAU
||| :|  | ||| :||||||:
GCAGTG-CAACAG-TAGTGTTG
Features
HUGO 2746
spacer
spacer