spacer

Target Detailed View


Hit information for ENSGACT00000008224

Gene Name AP3S1
Transcript ENSGACT00000008224
Gene ENSGACG00000006172
Description AP-3 complex subunit sigma-1 (Adapter-related protein complex 3 sigma- 1 subunit) (Sigma-adaptin 3a) (AP-3 complex sigma-3A subunit) (Sigma- 3A-adaptin) (Clathrin-associated/assembly/adapter protein, small 3). [Source:Uniprot/SWISSPROT;Acc:Q92572]
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
fru-miR-202 17.6773 -22.71 1.650230e-02 1.636690e-02 1.636690e-02 242 263
aaaaggGUACGGGAUACGGAGa
      ||| ||:||||||||
gtggtaCATTCCTTATGCCTCg
fru-miR-196a 17.3635 -20.48 2.397560e-02 2.397560e-02 1.251170e-03 430 451
ggGUUGUUGUACUUUGAUGGAu
  :||  :|||||||||||:|
ggTAAGCGCATGAAACTACTTc
fru-miR-30d 17.1543 -20.55 3.421290e-02 3.421290e-02 1.108980e-06 19 41
gaAGGUCAG-CCCCUACAAAUGu
  | ||||| |  |||||||||
gcTGCAGTCAGCCGATGTTTACc
fru-miR-1 17.0497 -13.83 5.157340e-02 5.026610e-02 9.063400e-08 232 254
uAUGUAUGAAGA-AAUGUAAGGu
 ||: ||:|| |  ||||||||
tTATTTATTTGTGGTACATTCCt
fru-let-7j 16.8405 -17.11 3.964660e-02 3.964660e-02 3.964660e-02 431 452
uugaCAUGUUUUUUGAUGGAGU
    | :|| :|||||||:|||
gtaaGCGCATGAAACTACTTCA
fru-miR-30b 16.6313 -18.66 5.744760e-02 5.582860e-02 1.108980e-06 18 41
UCGAC-UCACAU-CCUACAAAUGu
||||| |||  :  |||||||||
AGCTGCAGTCAGCCGATGTTTACc
fru-miR-196b 16.5267 -15.57 4.793480e-02 4.680410e-02 1.251170e-03 430 451
ggGUUGUUGAACUUUGAUGGAu
  :||  :| |||||||||:|
ggTAAGCGCATGAAACTACTTc
dre-miR-206 16.3175 -14.92 9.776360e-02 9.313670e-02 1.060870e-02 232 254
GGUGUGUGAA-GGAAUGUAAGGu
::|: :|:|| :  ||||||||
TTATTTATTTGTGGTACATTCCt
fru-miR-140 16.2129 -12.87 7.428350e-02 7.159150e-02 7.815390e-03 56 77
GAUGGUAUCCCAUUUUGGUGAc
:||||| |   | ||||:|||
TTACCAAAACCTCAAACTACTa
fru-miR-122 16.1083 -13.96 9.729000e-02 9.270710e-02 1.098760e-05 100 120
GUUUGUGGUAACAGUGUGAGGu
| ::: |::|| | |||||||
CTGGTCCTGTT-TGACACTCCc
xtr-miR-208 16.1083 -11.2 5.874550e-02 5.705330e-02 3.255080e-03 627 647
UGUUCGAAAUACGAGCAGAAUA
| | | ||||| | :|||||||
AAATGATTTAT-CATGTCTTAT
Features
HUGO 2013
spacer
spacer