spacer

Target Detailed View


Hit information for ENSGACT00000007826

Gene Name ASPM
Transcript ENSGACT00000007826
Gene ENSGACG00000005908
Description Abnormal spindle-like microcephaly-associated protein (Abnormal spindle protein homolog) (Asp homolog). [Source:Uniprot/SWISSPROT;Acc:Q8IZT6]
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
dre-miR-736 20.1182 -15.07 1.664090e-03 1.662710e-03 1.662710e-03 49 69
UUUUGAAAAACAAGCAGAAUG
||||: |||||| |||:|||:
AAAATATTTTGTACGTTTTAT
xtr-miR-208 17.8514 -10.35 1.228780e-02 1.221260e-02 1.117400e-03 48 69
UGUUCGAAAUACGAGCAGAAUA
| || : || ||: |||:||||
AAAAATATTTTGTACGTTTTAT
fru-miR-1 17.8514 -13.71 2.558150e-02 2.525710e-02 1.753450e-05 69 90
uAUGUAUGAAGAAAUGUAAGGu
 |::|  :||:|| |||||:|
tTGTAGCTTTTTTCACATTTCc
dre-miR-206 17.3966 -13.34 3.781750e-02 3.711130e-02 2.981430e-04 69 90
GGUGUGUGAAGGAAUGUAAGGu
::::|  :||::| |||||:|
TTGTAGCTTTTTTCACATTTCc
fru-let-7e 16.9418 -15.45 3.885860e-02 3.885860e-02 7.101940e-03 26 47
UUGAUAAGUUAGAUGAUGGAGU
| :|  ||| |:  ||||:|||
ATTTTGTCATTTCTCTACTTCA
fru-let-7a 16.7144 -15.2 5.195770e-02 5.195770e-02 7.101940e-03 25 47
uUGAUAUGUUGGA-UGAUGGAGU
 |:| |:: |::|  ||||:|||
cATTTTGTCATTTCTCTACTTCA
fru-let-7g 16.1459 -14.07 8.803700e-02 8.427300e-02 7.101940e-03 25 47
uUGAUAUGUUUGA-UGAUGGAGU
 |:| |:: | :|  ||||:|||
cATTTTGTCATTTCTCTACTTCA
fru-miR-21 15.8384 -6.85 6.823990e-02 6.596360e-02 6.772560e-03 1 11
cgguuguggucagacUAUUCGAu
               |||||||
------------taaATAAGCTt
Features
HUGO 19048
spacer
spacer