spacer

Target Detailed View


Hit information for ENSGACT00000004759

Gene Name MON2
Transcript ENSGACT00000004759
Gene ENSGACG00000003609
Description MON2 homolog [Source:RefSeq_peptide;Acc:NP_055841]
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
fru-miR-122 18.4121 -21.62 1.012400e-02 1.007290e-02 1.046830e-08 452 473
GUUUGUGGUAACAGUGUGAGGU
||||: :|: ||| |||:||||
CAAATCTCGCTGTAACATTCCA
fru-miR-200a 17.4373 -20.36 2.608170e-02 4.536300e-03 5.213130e-04 326 347
UGUAGCAAUGGUCUGUCACAAU
||| :||     |||||||||:
ACAGTGTGTGGTGACAGTGTTG
fru-miR-20 17.0304 -16.13 5.525600e-02 5.375710e-02 7.615040e-03 418 441
gaUGGACG-UGAUAUUCGUGAAAU
  |::| | || :|:||||:||||
acATTTTCAACGGTGAGCATTTTA
dre-miR-141 16.8958 -20.63 3.958430e-02 3.881110e-02 2.260400e-04 326 347
cGUAGCAAUGGUCUGUCACAAU
 || :||     |||||||||:
aCAGTGTGTGGTGACAGTGTTG
fru-miR-216b 16.6792 -15.07 3.444600e-02 3.385950e-02 2.729780e-05 241 262
aguguCAACGGACGUCUCUAAu
     |||  |||::||||||
cttgtGTTCGCTGTGGAGATTt
fru-miR-1 16.4625 -14.93 8.548400e-02 8.193220e-02 2.409680e-07 451 473
UAUGUAUGAAGA-AAUGUAAGGU
| | || :  || | ||||||||
ACAAATCTCGCTGTAACATTCCA
fru-miR-200a 15.8127 -11.16 9.841330e-02 4.536300e-03 5.213130e-04 257 279
UGUAGCAAUGGU-CUGUCACAAU
| ||: | |  |  :|||||||:
AGATTTTAAAAATTGCAGTGTTG
fru-miR-429 15.8127 -15.09 9.762980e-02 9.301540e-02 8.651860e-03 326 347
UGCCGUAAUGGUCUGUCAUAAU
|| |::|     ||||||:||:
ACAGTGTGTGGTGACAGTGTTG
Features
HUGO 29177
spacer
spacer