spacer

Target Detailed View


Hit information for ENSGACT00000003060

Gene Name NEDD9
Transcript ENSGACT00000003060
Gene ENSGACG00000002344
Description Enhancer of filamentation 1 (HEF1) (CRK-associated substrate-related protein) (CAS-L) (CasL) (p105) (Protein NEDD9) (Renal carcinoma antigen NY-REN-12). [Source:Uniprot/SWISSPROT;Acc:Q14511]
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
fru-miR-18 17.5207 -18.54 2.160790e-02 2.137610e-02 1.285910e-10 128 150
auagaCGUGA-UCUACGUGGAAU
     |:::| ||| ||||||||
gtggcGTGTTCAGAAGCACCTTA
dre-miR-206 17.4119 -15.58 3.730450e-02 3.661730e-02 1.490710e-06 105 127
gGUGUGUGAAGG-AAUGUAAGGu
 :| || :||:| | |||||||
gTAGACCTTTTCATAACATTCCt
fru-miR-1 17.1943 -11.67 4.548260e-02 4.446380e-02 1.463230e-07 107 127
UAUGUAUGAAGAAAUGUAAGGu
| || | :||| | |||||||
AGACCT-TTTCATAACATTCCt
dre-miR-730 16.8949 -18.31 4.470660e-02 4.372200e-02 4.716930e-03 347 369
uGUGUGUCGUACGUGUUACUCCu
 :|:  ||    ||||||||||
tTATTGAGACCACACAATGAGGc
dre-miR-732 16.759 -23.08 3.921580e-02 3.845680e-02 1.946410e-03 154 176
ugGCUCUCA-AGAGACGAAACuc
  :| |||| |:|||||||||
gaTGTGAGTGTTTCTGCTTTGtt
fru-miR-132 16.4325 -14.82 4.360610e-02 4.266900e-02 2.333770e-03 43 63
GCUGGUACCGACAUCUGACAAu
| |:: | | ||||||:||||
CTATTTTTG-TGTAGATTGTTt
fru-miR-92 16.4325 -17.79 3.868790e-02 3.794910e-02 3.794910e-02 79 100
UGUCCGGCCCUGUUCACGUUAU
|:|  |  | ::|:|||||:||
ATATACGTGTGTAGGTGCAGTA
fru-miR-212 16.188 -14.82 6.154380e-02 5.968820e-02 3.414420e-04 43 63
ucgguacugACAUCUGACAAu
         ||||||:||||
ctatttttgTGTAGATTGTTt
dre-miR-461 16.106 -16.2 7.728960e-02 7.437820e-02 6.703170e-04 108 129
aaccguAAAUCGGGUAAGGACu
      || |   ||||||||
gaccttTTCATAACATTCCTGt
dre-miR-729 15.5237 -16.67 8.636410e-02 8.273980e-02 8.373400e-03 2 27
uugggUCCAGCA--UAGUAUGGGUAc
     | ||:||  || :|||||:|
tttggATGTTGTAAATAGTACCCGTt
fru-miR-100 14.8001 -10.52 6.537730e-02 6.328600e-02 1.632630e-03 68 89
guguUCAAGCCUAGAUGCCCAa
    :|||:| || |||| ||
tgatGGTTTGAATATACGTGTg
Features
HUGO 7733
spacer
spacer