spacer

Target Detailed View


Hit information for ENSGACT00000001495

Gene Name NECAP2
Transcript ENSGACT00000001495
Gene ENSGACG00000001151
Description Adaptin ear-binding coat-associated protein 2 (NECAP-2). [Source:Uniprot/SWISSPROT;Acc:Q9NVZ3]
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
dre-miR-206 18.1965 -28.49 1.844990e-02 1.828070e-02 2.598410e-08 22 46
GGUGUGUG---AAGGAAUGUAAGGU
||||||||    |||  ||||||||
CCACACACAGGCTCCACACATTCCA
dre-miR-150 16.9045 -20.52 1.946930e-02 1.928100e-02 1.928100e-02 45 66
GUGACCAUGUUCCUAACCCUCu
||: |  |::| |||||||:|
CATGGACATGATGATTGGGGGc
fru-miR-221 16.7168 -13.05 4.006990e-02 3.927770e-02 1.008280e-04 132 154
cuUUGGGUCGUCUGUUACAUCGa
  | :::  || | ||||||||
acATTTTCTCATAAAATGTAGCc
fru-miR-1 16.6891 -14.09 7.041760e-02 4.047700e-03 6.640890e-06 26 46
UAUGUAUGAAGAAAUGUAAGGU
| ||| :| ||   ||||||||
ACACAGGC-TCCACACATTCCA
dre-miR-34b 16.6096 -19.3 6.183970e-02 5.996640e-02 9.081220e-06 414 436
GUUAGUCGAUUGUUGUGACGGAU
||||| |:|   ||::|||:||:
CAATCTGTTCTAAATGCTGTCTG
fru-miR-1 16.3661 -22.13 9.278970e-02 4.047700e-03 6.640890e-06 194 215
UAUGUAUGAAGAAAUGUAAGgu
:|||||||||:|||||| ||
GTACATACTTTTTTACAATCat
fru-miR-217 15.9354 -18.08 7.339480e-02 7.076610e-02 6.082030e-03 413 434
GGUUAGUCAAGGACUACGUCAu
:||||| ||||:  |||| ||
TCAATCTGTTCTAAATGCTGTc
fru-miR-222 15.6808 -10.54 7.750680e-02 7.457930e-02 6.240100e-04 131 154
cUCUGGGUCAUCGGUCUACAUCGa
 | |:::  |  : | |||||||
aACATTTTCTCATAAAATGTAGCc
Features
HUGO 25528
spacer
spacer