spacer

Target Detailed View


Hit information for ENSGACT00000000958

Gene Name MED11
Transcript ENSGACT00000000958
Gene ENSGACG00000000744
Description mediator of RNA polymerase II transcription, subunit 11 homolog [Source:RefSeq_peptide;Acc:NP_001001683]
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
fru-miR-1 17.8093 -14.03 2.654700e-02 2.209150e-03 5.599590e-05 151 172
UAUGUAUGAAGAAAUGUAAGGu
||::| ||| : |||||||:|
ATGTAGACTGTGTTACATTTCt
fru-miR-148 17.1617 -15.32 3.646870e-02 3.581170e-02 3.581170e-02 263 284
UGUUUCAAGACAUUACGUGACu
:||| ||     |||||||||
GCAATGTAAAAAAATGCACTGc
dre-miR-206 16.9458 -14.71 5.643690e-02 5.487390e-02 6.879690e-04 151 172
gGUGUGUGAAGGAAUGUAAGGu
 :::| ||| : |||||||:|
aTGTAGACTGTGTTACATTTCt
fru-miR-1 16.7299 -15.37 6.798960e-02 2.209150e-03 5.599590e-05 223 243
UAUGUAUGAAGAAAUGUAAGGu
|||: ||:|| |||:|||||:
ATAT-TATTTGTTTGCATTCTt
xtr-miR-33b 16.3409 -15.18 9.383510e-02 8.956710e-02 8.022270e-03 201 219
guuacguUGUUGUUACGUg
       |:| |||||||
tttcagcATATCAATGCAa
xtr-miR-33a 16.3409 -13.26 8.982640e-02 8.956710e-02 8.022270e-03 199 219
GUUACGUUG-AU-GUUACGUg
|: | ||:| || |||||||
CGTTTCAGCATATCAATGCAa
fru-miR-152 16.2982 -14.1 7.068180e-02 6.824170e-02 4.656930e-03 263 284
UGUUUCAAGACAAUACGUGACu
:||| ||      ||||||||
GCAATGTAAAAAAATGCACTGc
fru-miR-138 16.1903 -17.7 8.264390e-02 7.932110e-02 7.325100e-03 30 50
ccgGAC-UAAGUGUUGUGGUCGa
   ||| |||::|  |||||||
tcaCTGTATTTGC--CACCAGCc
fru-miR-135b 16.1903 -16.32 7.472100e-02 7.199760e-02 5.183660e-03 247 268
gucuauCCUUAUUUUUCGGUAU
      |||||||||||| ||:
ttgtctGGAATAAAAAGCAATG
dre-miR-499 15.9744 -20.64 9.676290e-02 9.222880e-02 8.506150e-03 271 297
aUUUGUA-GUGACGU----UCAGAAUU
 ||| || |||||||    ||||||::
aAAAAATGCACTGCAAAGTAGTCTTGG
fru-miR-125b 15.7585 -14.85 5.139000e-02 5.139000e-02 4.778940e-03 106 127
aGUGUUCAAUCCCAGAGUCCCU
 :|::  || |  |||:||||:
aTATGTTTTTGTTTCTTAGGGG
fru-miR-365 15.6506 -12.24 3.333090e-02 3.278150e-02 3.278150e-02 1 9
uauuccuaaaaauCCCCGUAAu
             ||||||||
-------------GGGGCATTc
fru-miR-125a 15.3268 -16.6 7.163550e-02 6.912990e-02 4.778940e-03 105 127
GUGU-CCAAUUCCCAGAGUCCCU
:|:| | ||  |  |||:||||:
TATATGTTTTTGTTTCTTAGGGG
Features
HUGO 32687
spacer
spacer