spacer

Target Detailed View


Hit information for ENSGACT00000000125

Gene Name CNN3
Transcript ENSGACT00000000125
Gene ENSGACG00000000098
Description Calponin-3 (Calponin, acidic isoform). [Source:Uniprot/SWISSPROT;Acc:Q15417]
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
fru-miR-1 19.2356 -18.19 7.517920e-03 7.489730e-03 2.040610e-06 475 495
UAUGUAUGAAGAAAUGUAAGGU
|||||| :||| | ||||||||
ATACAT-TTTCATAACATTCCA
dre-miR-206 18.9132 -22.42 9.656010e-03 9.609540e-03 2.833200e-07 473 495
ggUGUGUGAAGG-AAUGUAAGGU
  |:|||:||:| | ||||||||
agATACATTTTCATAACATTCCA
fru-miR-429 17.0864 -21.65 3.459390e-02 3.400240e-02 6.021420e-05 10 29
uGCCGUAAUGGUCUGUCAUAAU
 ||||  | |||  ||||||||
cCGGC--TCCCAATCAGTATTA
dre-miR-457b 17.0864 -15.06 4.888160e-02 4.888160e-02 4.888160e-02 283 304
gAGGUCAUAAAUACACGACGAa
 |:||| | | :  |||||||
aTTCAGCAATAGGCTGCTGCTc
fru-miR-137 16.764 -12.02 3.558030e-02 3.495480e-02 2.965400e-04 273 294
AUGCGCAUAA-GAAUUCGUUAUU
||:|  ||||  || |||||||:
TATG-ATATTAATTCAGCAATAG
fru-miR-200b 16.764 -14.01 4.502530e-02 4.402670e-02 1.209100e-06 8 29
aguaguaAUGGUCCGUCAUAAU
       | |||  ||||||||
ctccggcTCCCAATCAGTATTA
dre-miR-155 15.9043 -10.84 7.809950e-02 7.512760e-02 6.195410e-03 8 30
GGGGAU-AGUGCUAAUCGUAAUu
|:|| : || | || ||:||||
CTCCGGCTCCCAATCAGTATTAt
dre-miR-363 15.7969 -15.27 8.470260e-02 8.121450e-02 6.595800e-03 116 137
aUGUCUACCUAUGGCACGUUAa
 |:|||   ||:  |||||:|
aATAGAATAATGAAGTGCAGTg
fru-miR-29b 15.5819 -13.13 8.469760e-02 8.120990e-02 8.789980e-03 339 360
uGUGACUAAAGUUUACCACGAu
 ||||   | | | |||||:|
cCACTTTGTGCTACTGGTGTTt
Features
HUGO 2157
spacer
spacer