spacer

Target Detailed View


Hit information for ENSBTAT00000050177

Gene Name LOC616671
Transcript ENSBTAT00000050177
Gene ENSBTAG00000035689
Description
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
mmu-miR-685 17.8998 -26.68 8.691800e-03 3.584140e-03 3.584140e-03 279 299
cacggaGUGGAGUCGGUAACu
      ::||||||||||||
cactgcTGCCTCAGCCATTGc
bta-miR-34a 17.7066 -29.17 2.172930e-02 1.000000e-06 1.000000e-06 505 526
uGUUGGUCGAUUCUGUGACGGU
 ||||||||   |:||||||::
tCAACCAGCCCTGGCACTGCTG
bta-miR-34a 17.7066 -29.17 2.172930e-02 1.000000e-06 1.000000e-06 409 430
uGUUGGUCGAUUCUGUGACGGU
 ||||||||   |:||||||::
tCAACCAGCCCTGGCACTGCTG
mmu-miR-292-3p 17.4413 -24.75 1.477740e-02 1.000000e-06 1.000000e-06 572 595
uguGAGUUUUGGACCGCCGUGAAa
   ||||:   ||| :|||||||
tgcCTCAGCCACTGCTGGCACTTc
mmu-miR-292-3p 17.4413 -24.75 1.477740e-02 1.000000e-06 1.000000e-06 237 260
uguGAGUUUUGGACCGCCGUGAAa
   ||||:   ||| :|||||||
tgcCTCAGCCACTGCTGGCACTTc
mmu-miR-292-3p 17.4413 -24.75 1.477740e-02 1.000000e-06 1.000000e-06 381 404
uguGAGUUUUGGACCGCCGUGAAa
   ||||:   ||| :|||||||
tgcCTCAGCCACTGCTGGCACTTc
mmu-miR-292-3p 17.4413 -24.75 1.477740e-02 1.000000e-06 1.000000e-06 477 500
uguGAGUUUUGGACCGCCGUGAAa
   ||||:   ||| :|||||||
tgcCTCAGCCACTGCTGGCACTTc
mmu-miR-292-3p 17.128 -22.98 1.976620e-02 1.000000e-06 1.000000e-06 285 308
uguGAGUUUUGGACCGCCGUGAAa
   ||||:   :|| :|||||||
tgcCTCAGCCATTGCTGGCACTTc
bta-miR-34a 16.8635 -24.79 4.694910e-02 1.000000e-06 1.000000e-06 313 334
uGUUGGUCGAUUCUGUGACGGU
 || |||||   |:||||||::
tCATCCAGCCCTGGCACTGCTG
bta-miR-34a 16.8635 -26.32 4.694910e-02 1.000000e-06 1.000000e-06 265 286
uGUUGGUCGAUUCUGUGACGGU
 |||||||    |:||||||::
tCAACCAGGCCTGGCACTGCTG
bta-miR-34a 16.8635 -26.32 4.694910e-02 1.000000e-06 1.000000e-06 49 70
uGUUGGUCGAUUCUGUGACGGU
 |||||||    |:||||||::
tCAACCAGGCCTGGCACTGCTG
bta-miR-34a 16.8635 -26.32 4.694910e-02 1.000000e-06 1.000000e-06 97 118
uGUUGGUCGAUUCUGUGACGGU
 |||||||    |:||||||::
tCAACCAGGCCTGGCACTGCTG
bta-miR-34a 16.7581 -15.26 5.165230e-02 1.000000e-06 1.000000e-06 376 397
UGUUGGUCGAUUCUGUGACGGU
|| :|:: || || ||||||::
ACTGCTGCCTCAGCCACTGCTG
bta-miR-34a 16.7581 -15.26 5.165230e-02 1.000000e-06 1.000000e-06 567 588
UGUUGGUCGAUUCUGUGACGGU
|| :|:: || || ||||||::
ACTGCTGCCTCAGCCACTGCTG
bta-miR-34a 16.7581 -15.26 5.165230e-02 1.000000e-06 1.000000e-06 472 493
UGUUGGUCGAUUCUGUGACGGU
|| :|:: || || ||||||::
ACTGCTGCCTCAGCCACTGCTG
bta-miR-124a 16.6799 -26.9 3.829620e-02 3.148440e-03 3.148440e-03 102 124
aaCCGUA-AGUGGCGCACGGAAUU
  ||| |  |||:|| |||||||:
caGGCCTGGCACTGC-TGCCTTAG
bta-miR-34a 16.5473 -26.05 6.247080e-02 1.000000e-06 1.000000e-06 145 166
uGUUGGUCGAUUCUGUGACGGU
 ||:||||    |:||||||::
tCAGCCAGGCCTGGCACTGCTG
bta-let-7i 16.4419 -24.82 6.967650e-02 1.000000e-06 1.000000e-06 508 531
UUGUCGUG--UUUGAUGAUGGAGU
| |||| |  : |||:||:|||||
ACCAGCCCTGGCACTGCTGCCTCA
bta-let-7i 16.4419 -24.82 6.967650e-02 1.000000e-06 1.000000e-06 412 435
UUGUCGUG--UUUGAUGAUGGAGU
| |||| |  : |||:||:|||||
ACCAGCCCTGGCACTGCTGCCTCA
mmu-miR-467a 16.4419 -15.69 3.510940e-02 1.000000e-06 1.000000e-06 214 236
gcGUAUAUGU-ACGUCCGUGAAu
  | ||  || ||| |||||||
gcCTTAGCCACTGCTGGCACTTc
hsa-miR-650 16.417 -27.22 8.992160e-02 1.000000e-06 1.000000e-06 56 76
CAGGACUCUCGCGACGGAGga
| ||||: | :||||||||
GGCCTGGCACTGCTGCCTCag
hsa-miR-650 16.417 -27.22 8.992160e-02 1.000000e-06 1.000000e-06 152 172
CAGGACUCUCGCGACGGAGga
| ||||: | :||||||||
GGCCTGGCACTGCTGCCTCag
hsa-miR-650 16.417 -26.24 8.992160e-02 1.000000e-06 1.000000e-06 512 532
CAGGACUCUCGCGACGGAGga
| ||||: | :||||||||
GCCCTGGCACTGCTGCCTCag
hsa-miR-650 16.417 -27.22 8.992160e-02 1.000000e-06 1.000000e-06 559 579
CAGGACUCUCGCGACGGAGga
| ||||: | :||||||||
GGCCTGGCACTGCTGCCTCag
hsa-miR-650 16.417 -27.22 8.992160e-02 1.000000e-06 1.000000e-06 272 292
CAGGACUCUCGCGACGGAGga
| ||||: | :||||||||
GGCCTGGCACTGCTGCCTCag
hsa-miR-650 16.417 -27.22 8.992160e-02 1.000000e-06 1.000000e-06 368 388
CAGGACUCUCGCGACGGAGga
| ||||: | :||||||||
GGCCTGGCACTGCTGCCTCag
hsa-miR-650 16.417 -26.24 8.992160e-02 1.000000e-06 1.000000e-06 416 436
CAGGACUCUCGCGACGGAGga
| ||||: | :||||||||
GCCCTGGCACTGCTGCCTCag
hsa-miR-650 16.417 -27.22 8.992160e-02 1.000000e-06 1.000000e-06 464 484
CAGGACUCUCGCGACGGAGga
| ||||: | :||||||||
GGCCTGGCACTGCTGCCTCag
hsa-miR-650 16.417 -26.24 8.992160e-02 1.000000e-06 1.000000e-06 320 340
CAGGACUCUCGCGACGGAGga
| ||||: | :||||||||
GCCCTGGCACTGCTGCCTCag
bta-let-7i 16.3365 -19.12 7.729100e-02 1.000000e-06 1.000000e-06 486 507
uUGUCGUGUUUGAUGAUGGAGU
 || ||  : ||| ||:|||||
cACTGCTGGCACTTCTGCCTCA
bta-let-7i 16.3365 -19.12 7.729100e-02 1.000000e-06 1.000000e-06 390 411
uUGUCGUGUUUGAUGAUGGAGU
 || ||  : ||| ||:|||||
cACTGCTGGCACTTCTGCCTCA
bta-let-7i 16.3365 -19.12 7.729100e-02 1.000000e-06 1.000000e-06 246 267
uUGUCGUGUUUGAUGAUGGAGU
 || ||  : ||| ||:|||||
cACTGCTGGCACTTCTGCCTCA
bta-let-7i 16.3365 -19.12 7.729100e-02 1.000000e-06 1.000000e-06 222 243
uUGUCGUGUUUGAUGAUGGAGU
 || ||  : ||| ||:|||||
cACTGCTGGCACTTCTGCCTCA
bta-let-7g 16.3365 -20.08 7.103110e-02 1.000000e-06 1.000000e-06 486 507
uUGACAUGUUUGAUGAUGGAGU
 ||||   : ||| ||:|||||
cACTGCTGGCACTTCTGCCTCA
bta-let-7g 16.3365 -20.08 7.103110e-02 1.000000e-06 1.000000e-06 390 411
uUGACAUGUUUGAUGAUGGAGU
 ||||   : ||| ||:|||||
cACTGCTGGCACTTCTGCCTCA
bta-let-7g 16.3365 -20.08 7.103110e-02 1.000000e-06 1.000000e-06 246 267
uUGACAUGUUUGAUGAUGGAGU
 ||||   : ||| ||:|||||
cACTGCTGGCACTTCTGCCTCA
bta-let-7g 16.3365 -20.08 7.103110e-02 1.000000e-06 1.000000e-06 222 243
uUGACAUGUUUGAUGAUGGAGU
 ||||   : ||| ||:|||||
cACTGCTGGCACTTCTGCCTCA
hsa-miR-512-3p 16.3365 -24.3 5.887350e-02 1.000000e-06 1.000000e-06 237 259
cUGGAGUCGAU-ACUGUCGUGAA
 :||||||| | || ::||||||
tGCCTCAGCCACTGCTGGCACTT
hsa-miR-512-3p 16.3365 -24.3 5.887350e-02 1.000000e-06 1.000000e-06 381 403
cUGGAGUCGAU-ACUGUCGUGAA
 :||||||| | || ::||||||
tGCCTCAGCCACTGCTGGCACTT
hsa-miR-512-3p 16.3365 -24.97 5.887350e-02 1.000000e-06 1.000000e-06 285 307
cUGGAGUCGAU-ACUGUCGUGAA
 :||||||| | || ::||||||
tGCCTCAGCCATTGCTGGCACTT
hsa-miR-512-3p 16.3365 -24.3 5.887350e-02 1.000000e-06 1.000000e-06 572 594
cUGGAGUCGAU-ACUGUCGUGAA
 :||||||| | || ::||||||
tGCCTCAGCCACTGCTGGCACTT
hsa-miR-512-3p 16.3365 -24.3 5.887350e-02 1.000000e-06 1.000000e-06 477 499
cUGGAGUCGAU-ACUGUCGUGAA
 :||||||| | || ::||||||
tGCCTCAGCCACTGCTGGCACTT
mmu-miR-290-3p 16.2925 -18.45 3.523950e-02 1.000000e-06 1.000000e-06 213 236
cCCGAAUU-UUGAUCCGCCGUGAAa
 | ||||:  ||| | :|||||||
tGCCTTAGCCACT-GCTGGCACTTc
mmu-miR-699 16.2893 -25.71 6.262640e-02 1.000000e-06 1.000000e-06 145 166
gcUCGGUCC--AGCGUGACGGa
  |||||||  | |||||||:
tcAGCCAGGCCTGGCACTGCTg
bta-let-7b 16.2311 -25.6 9.584200e-02 1.000000e-06 1.000000e-06 507 531
UUGGU--GUGUUG-GAUGAUGGAGU
|||||  | :::| ||:||:|||||
AACCAGCCCTGGCACTGCTGCCTCA
bta-let-7b 16.2311 -25.6 9.584200e-02 1.000000e-06 1.000000e-06 411 435
UUGGU--GUGUUG-GAUGAUGGAGU
|||||  | :::| ||:||:|||||
AACCAGCCCTGGCACTGCTGCCTCA
bta-let-7b 16.2311 -26.81 9.584200e-02 1.000000e-06 1.000000e-06 267 291
UUGGU--GUGUUG-GAUGAUGGAGU
|||||  | :::| ||:||:|||||
AACCAGGCCTGGCACTGCTGCCTCA
bta-let-7b 16.2311 -26.81 9.584200e-02 1.000000e-06 1.000000e-06 51 75
UUGGU--GUGUUG-GAUGAUGGAGU
|||||  | :::| ||:||:|||||
AACCAGGCCTGGCACTGCTGCCTCA
bta-miR-34a 16.2311 -14.47 8.289660e-02 1.000000e-06 1.000000e-06 208 229
UGUUGGUCGAUUCUGUGACGGU
||  |:: || || ||||||::
ACTTCTGCCTTAGCCACTGCTG
bta-let-7c 16.2311 -25.68 8.931560e-02 1.000000e-06 1.000000e-06 51 75
UUGGUAUG--UUG-GAUGAUGGAGU
||||| :|  ::| ||:||:|||||
AACCAGGCCTGGCACTGCTGCCTCA
bta-let-7c 16.2311 -25.68 8.931560e-02 1.000000e-06 1.000000e-06 267 291
UUGGUAUG--UUG-GAUGAUGGAGU
||||| :|  ::| ||:||:|||||
AACCAGGCCTGGCACTGCTGCCTCA
bta-let-7i 16.2311 -24.82 8.569870e-02 1.000000e-06 1.000000e-06 316 339
uuGUCGUG--UUUGAUGAUGGAGU
  |||| |  : |||:||:|||||
tcCAGCCCTGGCACTGCTGCCTCA
bta-miR-34a 16.2311 -13.98 8.289660e-02 1.000000e-06 1.000000e-06 232 253
UGUUGGUCGAUUCUGUGACGGU
||  |:: || || ||||||::
ACTTCTGCCTCAGCCACTGCTG
bta-let-7i 16.1257 -22.77 9.497300e-02 1.000000e-06 1.000000e-06 53 75
uugUCGUGUU-UGAUGAUGGAGU
   :|| ::: |||:||:|||||
ccaGGCCTGGCACTGCTGCCTCA
mmu-miR-467a 16.1257 -17.42 4.687230e-02 1.000000e-06 1.000000e-06 240 260
GCGUAUAUGUACGUCCGUGAAu
| ||   || ||| |||||||
CTCAGCCAC-TGCTGGCACTTc
mmu-miR-467a 16.1257 -17.42 4.687230e-02 1.000000e-06 1.000000e-06 480 500
GCGUAUAUGUACGUCCGUGAAu
| ||   || ||| |||||||
CTCAGCCAC-TGCTGGCACTTc
bta-let-7i 16.1257 -22.77 9.497300e-02 1.000000e-06 1.000000e-06 556 578
uugUCGUGUU-UGAUGAUGGAGU
   :|| ::: |||:||:|||||
ccaGGCCTGGCACTGCTGCCTCA
bta-let-7c 16.1257 -22.34 9.884180e-02 1.000000e-06 1.000000e-06 511 531
UUGGUAUGUUGGAUGAUGGAGU
|:|| |:  | ||:||:|||||
AGCCCTGGCA-CTGCTGCCTCA
bta-let-7c 16.1257 -22.34 9.884180e-02 1.000000e-06 1.000000e-06 415 435
UUGGUAUGUUGGAUGAUGGAGU
|:|| |:  | ||:||:|||||
AGCCCTGGCA-CTGCTGCCTCA
bta-let-7c 16.1257 -22.34 9.884180e-02 1.000000e-06 1.000000e-06 319 339
UUGGUAUGUUGGAUGAUGGAGU
|:|| |:  | ||:||:|||||
AGCCCTGGCA-CTGCTGCCTCA
bta-let-7i 16.1257 -22.77 9.497300e-02 1.000000e-06 1.000000e-06 461 483
uugUCGUGUU-UGAUGAUGGAGU
   :|| ::: |||:||:|||||
ccaGGCCTGGCACTGCTGCCTCA
bta-let-7i 16.1257 -22.77 9.497300e-02 1.000000e-06 1.000000e-06 365 387
uugUCGUGUU-UGAUGAUGGAGU
   :|| ::: |||:||:|||||
ccaGGCCTGGCACTGCTGCCTCA
mmu-miR-467a 16.1257 -17.42 4.687230e-02 1.000000e-06 1.000000e-06 575 595
GCGUAUAUGUACGUCCGUGAAu
| ||   || ||| |||||||
CTCAGCCAC-TGCTGGCACTTc
bta-let-7i 16.1257 -22.77 9.497300e-02 1.000000e-06 1.000000e-06 149 171
uugUCGUGUU-UGAUGAUGGAGU
   :|| ::: |||:||:|||||
ccaGGCCTGGCACTGCTGCCTCA
mmu-miR-467a 16.1257 -17.42 4.687230e-02 1.000000e-06 1.000000e-06 384 404
GCGUAUAUGUACGUCCGUGAAu
| ||   || ||| |||||||
CTCAGCCAC-TGCTGGCACTTc
bta-let-7i 16.1257 -22.77 9.497300e-02 1.000000e-06 1.000000e-06 269 291
uugUCGUGUU-UGAUGAUGGAGU
   :|| ::: |||:||:|||||
ccaGGCCTGGCACTGCTGCCTCA
hsa-miR-512-3p 16.0203 -21.83 7.900090e-02 1.000000e-06 1.000000e-06 213 235
cUGGAGUCGAU-ACUGUCGUGAA
 :|||:||| | || ::||||||
tGCCTTAGCCACTGCTGGCACTT
mmu-miR-467a 16.0203 -16.17 5.158950e-02 1.000000e-06 1.000000e-06 287 308
gcguauauguACGUCCGUGAAu
          ||| |||||||
cctcagccatTGCTGGCACTTc
bta-let-7g 16.0203 -19.39 9.679750e-02 1.000000e-06 1.000000e-06 294 315
uUGACAUGUUUGAUGAUGGAGU
 |:||   : ||| ||:|||||
cATTGCTGGCACTTCTGCCTCA
mmu-miR-290-3p 15.9791 -12.41 4.712320e-02 1.000000e-06 1.000000e-06 285 308
cCCGAAUUUUGAUCCGCCGUGAAa
 | || |:   | | :|||||||
tGCCTCAGCCATTGCTGGCACTTc
mmu-miR-699 15.9699 -27.86 8.269140e-02 1.000000e-06 1.000000e-06 457 478
gcUCGGUCC--AGCGUGACGGa
  :||||||  | |||||||:
tcGGCCAGGCCTGGCACTGCTg
mmu-miR-699 15.9699 -27.86 8.269140e-02 1.000000e-06 1.000000e-06 361 382
gcUCGGUCC--AGCGUGACGGa
  :||||||  | |||||||:
tcGGCCAGGCCTGGCACTGCTg
bta-miR-124a 15.8407 -20.53 8.153150e-02 3.148440e-03 3.148440e-03 198 220
aaCCGUA-AGUGGCGCACGGAAUU
  ||| |  |||: | |||||||:
caGGCCTGGCACTTC-TGCCTTAG
hsa-miR-503 15.8407 -25.66 7.606990e-02 2.750690e-03 2.750690e-03 60 85
gaCGUCUUGAC-AAG--GGCGACGAU
  |||  :|||  ||  ||||||||:
tgGCACTGCTGCCTCAGCCGCTGCTG
hsa-miR-503 15.8407 -22.29 7.606990e-02 2.750690e-03 2.750690e-03 113 133
GACGUCUUGACAAGGGCGACGAU
|||| |  || |  ||||||||:
CTGCTG-CCT-TAGCCGCTGCTG
hsa-miR-512-3p 15.8095 -23.04 9.591840e-02 1.000000e-06 1.000000e-06 159 181
cUGGAGUC-GAUACUGUCGUGAa
 ||: | | ||  | |||||||
cACTGCTGCCTCAGCCAGCACTg
mmu-miR-699 15.757 -23.63 9.933650e-02 1.000000e-06 1.000000e-06 552 573
gcuCGGUCC--AGCGUGACGGa
   ||||||  | |||||||:
ttcGCCAGGCCTGGCACTGCTg
hsa-miR-371-3p 15.7358 -20.12 4.003100e-02 1.000000e-06 1.000000e-06 477 499
uguGAGUUUUCUACCGCCGUGAA
   ||||:    || :|||||||
tgcCTCAGCCACTGCTGGCACTT
hsa-miR-371-3p 15.7358 -20.12 4.003100e-02 1.000000e-06 1.000000e-06 572 594
uguGAGUUUUCUACCGCCGUGAA
   ||||:    || :|||||||
tgcCTCAGCCACTGCTGGCACTT
hsa-miR-371-3p 15.7358 -20.12 4.003100e-02 1.000000e-06 1.000000e-06 381 403
uguGAGUUUUCUACCGCCGUGAA
   ||||:    || :|||||||
tgcCTCAGCCACTGCTGGCACTT
hsa-miR-371-3p 15.7358 -20.12 4.003100e-02 1.000000e-06 1.000000e-06 237 259
uguGAGUUUUCUACCGCCGUGAA
   ||||:    || :|||||||
tgcCTCAGCCACTGCTGGCACTT
hsa-miR-371-3p 15.7358 -20.79 4.003100e-02 1.000000e-06 1.000000e-06 285 307
uguGAGUUUUCUACCGCCGUGAA
   ||||:    || :|||||||
tgcCTCAGCCATTGCTGGCACTT
mmu-miR-467a 15.7041 -13.41 6.867410e-02 1.000000e-06 1.000000e-06 190 212
gcguaUAUGUAC-GUCCGUGAAu
     || || | | |||||||
tcttcATCCAGGCCTGGCACTTc
mmu-miR-292-3p 15.5614 -19.04 8.293110e-02 1.000000e-06 1.000000e-06 192 212
ugugAGUUUUGGACCGCCGUGAAa
    || |::|||   |||||||
ttcaTCCAGGCCT---GGCACTTc
mmu-miR-685 15.4637 -20.19 8.715220e-02 3.584140e-03 3.584140e-03 26 45
caCGGAGUGGAGUCGGUAAcu
  ||||| ::|::||||||
caGCCTC-TTTTGGCCATTct
mmu-miR-290-3p 15.4569 -14.49 7.610190e-02 1.000000e-06 1.000000e-06 572 595
cCCGAAUU-UUGAUCCGCCGUGAAa
 | || |:  ||| | :|||||||
tGCCTCAGCCACT-GCTGGCACTTc
mmu-miR-290-3p 15.4569 -14.49 7.610190e-02 1.000000e-06 1.000000e-06 477 500
cCCGAAUU-UUGAUCCGCCGUGAAa
 | || |:  ||| | :|||||||
tGCCTCAGCCACT-GCTGGCACTTc
mmu-miR-290-3p 15.4569 -14.49 7.610190e-02 1.000000e-06 1.000000e-06 381 404
cCCGAAUU-UUGAUCCGCCGUGAAa
 | || |:  ||| | :|||||||
tGCCTCAGCCACT-GCTGGCACTTc
hsa-miR-371-3p 15.4211 -17.65 5.388670e-02 1.000000e-06 1.000000e-06 213 235
uguGAGUUUUCUACCGCCGUGAA
   ||:|:    || :|||||||
tgcCTTAGCCACTGCTGGCACTT
hsa-miR-621 15.0401 -17.49 8.718620e-02 3.586860e-03 3.586860e-03 68 88
uccauucgCGACAACGAUCGG
        || | ||||:|||
ctgcctcaGCCGCTGCTGGCC
hsa-miR-621 15.0401 -17.62 8.718620e-02 3.586860e-03 3.586860e-03 116 136
uccauucgCGACAACGAUCGG
        || | ||||:|||
ctgccttaGCCGCTGCTGGCC
Features
EntrezGene 616671
EntrezGene 786803
RefSeq_peptide_predicted XP_001254378
RefSeq_peptide_predicted XP_873847
spacer
spacer