spacer

Target Detailed View


Hit information for ENSBTAT00000049668

Gene Name LOC790304
Transcript ENSBTAT00000049668
Gene ENSBTAG00000035176
Description
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
hsa-miR-563 17.7704 -16.78 6.674430e-03 6.652210e-03 6.652210e-03 369 387
ccCUUUGCAUACAGUUGGA
  |||| |  |||||||||
caGAAAAGCCTGTCAACCT
mmu-miR-292-3p 17.6502 -22.7 1.216800e-02 1.000000e-06 1.000000e-06 41 65
uGUGAGUUUUGGACCG-CCGUGAAa
 ::||: :::| |||| |||||||
cTGCTTTGGGCATGGCTGGCACTTc
mmu-miR-292-3p 17.6502 -22.7 1.216800e-02 1.000000e-06 1.000000e-06 89 113
uGUGAGUUUUGGACCG-CCGUGAAa
 ::||: :::| |||| |||||||
cTGCTTTGGGCATGGCTGGCACTTc
mmu-miR-666-3p 17.6012 -25.91 3.442270e-02 6.800600e-04 6.800600e-04 246 267
ucGUCCGCUAGUGCGACGUCGG
  | |||  |: :|||||||||
gcCTGGCATTTCTGCTGCAGCC
bta-miR-31 17.582 -23.04 2.692530e-02 2.656600e-02 2.656600e-02 217 238
ucGAUACGG-UCGUAGAACGGA
  | | ||: ||:|||||||||
gcCCAGGCTGAGTATCTTGCCT
mmu-miR-666-3p 17.4958 -24.94 3.734100e-02 6.800600e-04 6.800600e-04 198 219
UCGUCCGCUAGUGCGACGUCGG
:|  |||  |: :|||||||||
GGATGGCCCTTCTGCTGCAGCC
mmu-miR-290-3p 17.4413 -22.13 1.201220e-02 1.000000e-06 1.000000e-06 41 65
ccCGAAUUUUG-AUCCGCCGUGAAa
  |||| :::| |:| :|||||||
ctGCTTTGGGCATGGCTGGCACTTc
mmu-miR-290-3p 17.4413 -22.13 1.201220e-02 1.000000e-06 1.000000e-06 89 113
ccCGAAUUUUG-AUCCGCCGUGAAa
  |||| :::| |:| :|||||||
ctGCTTTGGGCATGGCTGGCACTTc
bta-miR-93 17.3904 -20.15 2.428220e-02 2.398980e-02 2.398980e-02 117 138
auggaCGUGCUUGUCGUGAAAc
     |||:|: ::|||||||
ctcggGCATGGCTGGCACTTTt
mmu-miR-292-3p 17.3368 -27.13 1.628330e-02 1.000000e-06 1.000000e-06 113 137
uGUGAGUUUUGGACCG-CCGUGAAA
 ::| : :::| |||| ||||||||
cTGCCTCGGGCATGGCTGGCACTTT
hsa-miR-643 17.285 -14.11 1.535310e-02 1.523580e-02 1.523580e-02 451 473
GAUGGACUCGA-UCGUAUGUUCA
:||::| :|:| |  ||||||||
TTATTTAGGTTCATGATACAAGT
mmu-miR-290-3p 17.2324 -21.54 1.462070e-02 1.000000e-06 1.000000e-06 114 137
cCCGAAUUUUGAUCCGCCGUGAAA
 | || :::  |:| :||||||||
tGCCTCGGGCATGGCTGGCACTTT
hsa-miR-524-5p 17.1796 -18.99 3.713700e-02 3.645590e-02 3.645590e-02 346 367
cUCUUUCACGAAGGGAAACAUC
 ||:  || |||| ||||||:|
aAGGCCGTTCTTCACTTTGTGG
bta-miR-106 16.8635 -16.18 3.987280e-02 3.908830e-02 3.908830e-02 117 138
auggaCGUGACAUUCGUGAAAA
     |||: |  :||||||||
ctcggGCATGGCTGGCACTTTT
bta-miR-17-5p 16.7102 -22.33 4.672980e-02 4.565480e-02 4.565480e-02 112 138
uGAUGGA---CGUGACAUUCGUGAAAc
 ||:|||   |||: |  :|||||||
tCTGCCTCGGGCATGGCTGGCACTTTt
hsa-miR-302d 16.6799 -26.58 4.772840e-02 1.000000e-06 1.000000e-06 66 89
uguGAGUUUGUACC-UUCGUGAAu
   |||:::|||||  :||||||
tgcCTCGGGCATGGCTGGCACTTc
hsa-miR-302d 16.6799 -27.36 4.772840e-02 1.000000e-06 1.000000e-06 114 137
uguGAGUUUGUACC-UUCGUGAAu
   |||:::|||||  :||||||
tgcCTCGGGCATGGCTGGCACTTt
hsa-miR-302d 16.6799 -26.58 4.772840e-02 1.000000e-06 1.000000e-06 18 41
uguGAGUUUGUACC-UUCGUGAAu
   |||:::|||||  :||||||
tgcCTCGGGCATGGCTGGCACTTc
hsa-miR-512-5p 16.575 -22.6 4.588170e-02 4.484500e-02 4.484500e-02 208 230
cuuucACGGGAGUUCCGACUCAc
     |||   | |||||||||
tctgcTGCAGCCCAGGCTGAGTa
bta-miR-140 16.5473 -24.52 4.426150e-02 4.329630e-02 4.329630e-02 349 369
aGGCACCAAGAUGGGACACCAu
 ||||  ||| ||::||||||
gCCGTTCTTC-ACTTTGTGGTc
hsa-miR-888 16.5229 -12.09 3.907530e-02 1.752090e-03 1.752090e-03 462 482
acugacUGUCGAAAAACUCAU
      |||  | ||||||||
catgatACAAGTATTTGAGTA
hsa-miR-371-3p 16.4701 -22.65 1.987830e-02 1.000000e-06 1.000000e-06 89 112
uGUGAGUUUUCUACC-GCCGUGAA
 ::||: ::: |||| :|||||||
cTGCTTTGGGCATGGCTGGCACTT
hsa-miR-371-3p 16.4701 -22.65 1.987830e-02 1.000000e-06 1.000000e-06 41 64
uGUGAGUUUUCUACC-GCCGUGAA
 ::||: ::: |||| :|||||||
cTGCTTTGGGCATGGCTGGCACTT
mmu-miR-467a 16.4419 -17.02 3.510940e-02 1.000000e-06 1.000000e-06 91 113
gcguAUAUGUA-CGUCCGUGAAu
    |: :||| || |||||||
gcttTGGGCATGGCTGGCACTTc
hsa-miR-219-2-3p 16.4419 -14.51 4.869240e-02 4.752590e-02 4.752590e-02 511 533
uGUCUACA-GGUCGGUGUUAAGA
 ||||| | : ||: ||||||:|
tCAGATTTATGAGTAACAATTTT
mmu-miR-467a 16.4419 -17.02 3.510940e-02 1.000000e-06 1.000000e-06 43 65
gcguAUAUGUA-CGUCCGUGAAu
    |: :||| || |||||||
gcttTGGGCATGGCTGGCACTTc
hsa-miR-330-3p 16.2603 -18.48 5.867680e-02 1.655600e-03 1.655600e-03 26 49
aGAGACGUCCG-GCACACGAAACg
 | : || ||| | | |||||||
gCATGGCTGGCACTTCTGCTTTGg
mmu-miR-295 16.2603 -19.1 6.195290e-02 1.487450e-04 1.487450e-04 114 137
uCUGAGUUUUCAUC-AUCGUGAAA
 | |||:::  |:| |:|||||||
tGCCTCGGGCATGGCTGGCACTTT
hsa-miR-330-3p 16.2603 -18.48 5.867680e-02 1.655600e-03 1.655600e-03 74 97
aGAGACGUCCG-GCACACGAAACg
 | : || ||| | | |||||||
gCATGGCTGGCACTTCTGCTTTGg
bta-let-7g 16.2311 -19.1 7.878850e-02 1.000000e-06 1.000000e-06 171 192
uUGACAUGUUUGAUGAUGGAGU
 |||| |:: |:  ||:||||:
tACTGCATGCATGTCTGCCTCG
bta-let-7i 16.2311 -19.4 8.569870e-02 1.000000e-06 1.000000e-06 51 72
uUGUCGUGUUUGAUGAUGGAGU
 |::||  : ||| ||:||||:
cATGGCTGGCACTTCTGCCTCG
bta-let-7i 16.2311 -19.4 8.569870e-02 1.000000e-06 1.000000e-06 99 120
uUGUCGUGUUUGAUGAUGGAGU
 |::||  : ||| ||:||||:
cATGGCTGGCACTTCTGCCTCG
bta-let-7i 16.2311 -19.4 8.569870e-02 1.000000e-06 1.000000e-06 3 24
uUGUCGUGUUUGAUGAUGGAGU
 |::||  : ||| ||:||||:
cATGGCTGGCACTTCTGCCTCG
bta-let-7i 16.2311 -19.81 8.569870e-02 1.000000e-06 1.000000e-06 171 192
uUGUCGUGUUUGAUGAUGGAGU
 || |||:: |:  ||:||||:
tACTGCATGCATGTCTGCCTCG
mmu-miR-467a 16.1257 -19.37 4.687230e-02 1.000000e-06 1.000000e-06 114 137
GCGUA-UAUGUA-CGUCCGUGAAu
:|| | : :||| || |||||||
TGCCTCGGGCATGGCTGGCACTTt
mmu-miR-467a 16.1257 -18.59 4.687230e-02 1.000000e-06 1.000000e-06 66 89
GCGUA-UAUGUA-CGUCCGUGAAu
:|| | : :||| || |||||||
TGCCTCGGGCATGGCTGGCACTTc
mmu-miR-467a 16.1257 -18.59 4.687230e-02 1.000000e-06 1.000000e-06 18 41
GCGUA-UAUGUA-CGUCCGUGAAu
:|| | : :||| || |||||||
TGCCTCGGGCATGGCTGGCACTTc
mmu-miR-292-3p 16.0836 -18.23 5.170440e-02 1.000000e-06 1.000000e-06 1 17
ugugaguuUUGGACCG-CCGUGAAa
        ::| |||| |||||||
--------GGCATGGCTGGCACTTc
hsa-miR-302d 16.0505 -19.01 8.387080e-02 1.000000e-06 1.000000e-06 42 65
uguGAGUUUGUACC-UUCGUGAAu
   :|::::|||||  :||||||
tgcTTTGGGCATGGCTGGCACTTc
hsa-miR-550 16.0505 -28.98 7.266530e-02 6.056260e-05 6.056260e-05 57 78
cCCGAGAAUGAGGGAGUCCGUGa
 ||| ||| || ||||:||||:
tGGCACTT-CTGCCTCGGGCATg
hsa-miR-550 16.0505 -28.98 7.266530e-02 6.056260e-05 6.056260e-05 9 30
cCCGAGAAUGAGGGAGUCCGUGa
 ||| ||| || ||||:||||:
tGGCACTT-CTGCCTCGGGCATg
hsa-miR-302d 16.0505 -19.01 8.387080e-02 1.000000e-06 1.000000e-06 90 113
uguGAGUUUGUACC-UUCGUGAAu
   :|::::|||||  :||||||
tgcTTTGGGCATGGCTGGCACTTc
hsa-miR-550 16.0505 -28.98 7.266530e-02 6.056260e-05 6.056260e-05 105 126
cCCGAGAAUGAGGGAGUCCGUGa
 ||| ||| || ||||:||||:
tGGCACTT-CTGCCTCGGGCATg
mmu-miR-467a 16.0203 -16.96 5.158950e-02 1.000000e-06 1.000000e-06 1 17
gcguauaUGUA-CGUCCGUGAAu
       :||| || |||||||
------gGCATGGCTGGCACTTc
hsa-miR-888 15.9933 -14.72 6.039690e-02 1.752090e-03 1.752090e-03 505 525
ACUGACUGUCGAAAAACUCAU
|| :|| ||| ||| ||||||
TGTTTGTCAGATTTATGAGTA
hsa-miR-560 15.8634 -23.18 2.683740e-02 2.648050e-02 2.648050e-02 285 302
ccGCCGGCCGGCCGCGUGCG
  | ||| |:  ||||||||
ttCAGCCAGT--GCGCACGC
hsa-miR-302c 15.8407 -20.72 9.575830e-02 1.000000e-06 1.000000e-06 66 89
gguGACUUUGUACC-UUCGUGAAu
   || :::|||||  :||||||
tgcCTCGGGCATGGCTGGCACTTc
hsa-miR-302c 15.8407 -21.5 9.575830e-02 1.000000e-06 1.000000e-06 114 137
gguGACUUUGUACC-UUCGUGAAu
   || :::|||||  :||||||
tgcCTCGGGCATGGCTGGCACTTt
hsa-miR-302c 15.8407 -20.72 9.575830e-02 1.000000e-06 1.000000e-06 18 41
gguGACUUUGUACC-UUCGUGAAu
   || :::|||||  :||||||
tgcCTCGGGCATGGCTGGCACTTc
mmu-miR-290-3p 15.7703 -16.53 5.713220e-02 1.000000e-06 1.000000e-06 1 17
cccgaauuuugAUCCGCCGUGAAa
           |:| :|||||||
-------ggcaTGGCTGGCACTTc
mmu-miR-295 15.7358 -17.85 9.867760e-02 1.487450e-04 1.487450e-04 66 89
uCUGAGUUUUCAUC-AUCGUGAAa
 | |||:::  |:| |:||||||
tGCCTCGGGCATGGCTGGCACTTc
mmu-miR-295 15.7358 -17.85 9.867760e-02 1.487450e-04 1.487450e-04 18 41
uCUGAGUUUUCAUC-AUCGUGAAa
 | |||:::  |:| |:||||||
tGCCTCGGGCATGGCTGGCACTTc
hsa-miR-371-3p 15.6309 -26.59 4.421080e-02 1.000000e-06 1.000000e-06 113 136
uGUGAGUUUUCUACC-GCCGUGAA
 ::| : ::: |||| :|||||||
cTGCCTCGGGCATGGCTGGCACTT
hsa-miR-371-3p 15.6309 -26.59 4.421080e-02 1.000000e-06 1.000000e-06 65 88
uGUGAGUUUUCUACC-GCCGUGAA
 ::| : ::: |||| :|||||||
cTGCCTCGGGCATGGCTGGCACTT
hsa-miR-371-3p 15.6309 -26.59 4.421080e-02 1.000000e-06 1.000000e-06 17 40
uGUGAGUUUUCUACC-GCCGUGAA
 ::| : ::: |||| :|||||||
cTGCCTCGGGCATGGCTGGCACTT
hsa-miR-371-3p 14.8965 -19 8.790030e-02 1.000000e-06 1.000000e-06 1 16
ugugaguuUUCUACC-GCCGUGAA
        :: |||| :|||||||
--------GGCATGGCTGGCACTT
Features
EntrezGene 790304
RefSeq_dna_predicted XM_001256816
RefSeq_peptide_predicted XP_001256817
spacer
spacer