spacer

Target Detailed View


Hit information for ENSBTAT00000032645

Gene Name LOC533202
Transcript ENSBTAT00000032645
Gene ENSBTAG00000023795
Description
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
hsa-miR-297 19.1178 -22.9 8.466700e-03 8.430960e-03 4.481810e-05 337 359
GUACG--UGUACGUGUGUAUGUA
|:|||  |::||:::||||||||
CGTGCAGATGTGTGTACATACAT
mmu-miR-673-3p 18.3888 -31.68 1.936480e-02 1.917850e-02 1.434120e-03 160 182
ccacGUGUCUUGAGUCGGGGCCU
    | || |:| |||||||||:
tgctCTCACAGCCCAGCCCCGGG
mmu-miR-466d-5p 18.0429 -26.11 1.652940e-02 1.000000e-06 1.000000e-06 337 358
GUACAUGUACAUGCGUGUGUGU
|:|| | ||||::|:|||:|||
CGTGCAGATGTGTGTACATACA
hsa-miR-324-3p 17.7925 -27.44 3.587640e-02 3.524050e-02 6.361560e-03 112 129
GGUCGUCGUGGACCCCGUCa
||| ||||:|  |||||||
CCACCAGCGC--GGGGCAGg
mmu-miR-466a-5p 17.7168 -19.53 2.514120e-02 1.000000e-06 1.000000e-06 339 360
auacaUGUACAUGUGUGUGUAU
     |::|||::|||:||||:
tgcagATGTGTGTACATACATG
hsa-miR-637 17.5508 -32.57 5.494120e-02 5.345920e-02 1.898130e-04 168 190
ugCGUCUCGGGCUUUCGGGGGUCa
  ||  |||||  ::||||||||
caGCCCAGCCC-CGGGCCCCCAGc
hsa-miR-885-5p 17.4994 -30.04 1.049800e-02 3.406390e-03 3.406390e-03 116 137
ucucCGUCCCAUCACAUUACCU
    ||:||| || |||:|||:
cagcGCGGGGCAGGGTAGTGGG
mmu-miR-466e-5p 17.4994 -17.8 2.865230e-02 1.000000e-06 1.000000e-06 339 360
auacaUGUACAUGUGUGUGUAg
     |::|||::|||:||||
tgcagATGTGTGTACATACATg
mmu-miR-466b-5p 17.4994 -19.42 2.862640e-02 1.000000e-06 1.000000e-06 339 360
guacaUGUACAUGUGUGUGUAg
     |::|||::|||:||||
tgcagATGTGTGTACATACATg
mmu-miR-466h 17.4994 -19.53 2.817400e-02 1.000000e-06 1.000000e-06 361 382
AUGUGUGUUCGUGUACGUGUGU
||:|| |:  ::::||||||:|
TATACCCGTCTGTGTGCACATA
hsa-miR-770-5p 17.4153 -23.4 1.523740e-02 1.512190e-02 1.512190e-02 27 49
acCGGGACUGUGCACCAUGACCU
  |:  || ||:|  |||||||:
gaGTGGTGCCATGGTGTACTGGG
hsa-miR-323-5p 17.3908 -25.38 2.376260e-02 2.348250e-02 1.625660e-03 133 156
CGCUUG--CGCGGUGCCUGGUGGa
|:|::|  | | ||| |||||||
GTGGGCTGGAGGCACTGACCACCg
mmu-miR-762 17.3908 -30.71 7.999950e-02 7.688320e-02 8.316920e-05 156 179
CGAGACAGGGCCG--GGGUCGGGG
|| ||| :|:  |  |||||||||
GCACTGCTCTCACAGCCCAGCCCC
mmu-miR-466f-5p 17.3908 -24.48 1.814930e-02 1.000000e-06 1.000000e-06 341 362
GUACGUGUACGUGUGUGUGCAU
||  ::::||:|||:|||:|||
CAGATGTGTGTACATACATGTA
gga-miR-757 17.3699 -19.47 3.469520e-02 3.410020e-02 1.254650e-02 314 333
cUUAGGGUAGACGUCGAGACg
 || |||| | | |||||||
cAAGCCCACCAG-AGCTCTGa
hsa-miR-766 17.2821 -26.34 3.761300e-02 3.691440e-02 3.691440e-02 124 144
cgacUCCGACACCCCGACCUCa
    :||: || |||||||||
ggcaGGGTAGT-GGGCTGGAGg
mmu-miR-540-3p 17.2433 -22.69 2.951770e-02 2.908630e-02 3.763350e-04 317 336
gguccuagCUGGAGACUGGA
        || |||||||||
gcccaccaGAGCTCTGACCT
mmu-miR-466c-5p 17.1734 -17.29 3.907220e-02 1.000000e-06 1.000000e-06 339 360
auacaUGUACGUGUGUGUGUAg
     |::||:::|||:||||
tgcagATGTGTGTACATACATg
hsa-miR-671-5p 17.0908 -26.28 5.524530e-02 5.374700e-02 1.130450e-04 44 65
gaggUCGGGGAGGUCCCGAAGGA
    :|  :||:|| ||||||||
actgGGGGTCTTCA-GGCTTCCT
hsa-miR-493 16.8473 -22.24 3.642270e-02 3.576740e-02 3.576740e-02 36 57
GGACCGUGUGUCAUCUGGAAGU
| |||:::|| | :|::|||||
CATGGTGTACTGGGGGTCTTCA
hsa-miR-635 16.6581 -17.73 3.359520e-02 3.303710e-02 1.867660e-04 60 82
ccuguaacaAAGUCACGGGUUCa
         | ||| |||||||
cttcctcccTGCAGAGCCCAAGg
bta-miR-484 16.6299 -30.46 6.023580e-02 5.845750e-02 2.415740e-05 89 111
uAGC-CCUCCCCUGACUCGGACU
 ||| ||:   |:|||:|||||:
cTCGAGGGCAAGGCTGGGCCTGG
bta-miR-148b 16.6299 -24.82 3.310840e-02 4.347220e-03 5.640760e-04 24 48
UGUUUCAAGAC---ACUACGUGACU
||::|||  ||   ||:||:||||:
ACGGAGTGGTGCCATGGTGTACTGG
bta-miR-148a 16.6299 -24.46 3.269880e-02 4.347220e-03 5.640760e-04 24 48
UGUUUCAAGAC---AUCACGUGACU
||::|||  ||   |:|||:||||:
ACGGAGTGGTGCCATGGTGTACTGG
bta-let-7i 16.5212 -20.3 6.442530e-02 6.239380e-02 1.366600e-06 71 92
uUGUCGUGUUUGAUGAUGGAGU
 | ||| |||:   ||:||||:
cAGAGCCCAAGGGTCTGCCTCG
hsa-miR-874 16.5212 -31 6.581680e-02 6.369760e-02 3.818790e-07 112 133
agccaggGAGCCCGGUCCCGUC
       | |||| |||||:||
ccaccagCGCGGGGCAGGGTAG
hsa-miR-943 16.4959 -21.88 3.488540e-02 3.428390e-02 6.284410e-03 176 196
gaccUCCUGCCGUUGUCAGUC
    :|| |  ||:|||||||
ccccGGGCCCCCAGCAGTCAG
rno-miR-352 16.3867 -16.84 4.751350e-02 4.640240e-02 4.640240e-02 145 165
aUGAUACGUUGGAUGAUGAGA
 |||:  || |  |||:||||
cACTGACCACCGCACTGCTCT
bta-miR-138 16.3336 -24.01 6.806400e-02 6.579930e-02 1.044900e-05 98 120
gcCGGACUAAGUGUUGUGGUCGa
  | |||:  |  : |||||||
aaGGCTGGGCCTGGCCACCAGCg
hsa-miR-519e 16.3038 -17.6 4.801410e-02 4.687970e-02 4.687970e-02 128 149
uugugagauuuuCCUCCGUGAa
            |||||||||
gggtagtgggctGGAGGCACTg
mmu-miR-546 16.2129 -20.44 6.426530e-02 6.224380e-02 3.874290e-03 103 118
cugaGGCACGGUGGUa
    ||  |||||||
tgggCCTGGCCACCAg
mmu-miR-466h 16.1951 -20.34 8.392520e-02 1.000000e-06 1.000000e-06 335 356
auGUGUGUUCGUGUACGUGUGU
  |:::||: ::::||:|||:|
ctCGTGCAGATGTGTGTACATA
hsa-miR-652 16.1682 -25.62 2.165800e-02 2.142520e-02 2.142520e-02 19 39
guguugggaUCACCGCGGUAa
         |||||:|||||
ggcccacggAGTGGTGCCATg
hsa-miR-183 16.0864 -14.18 4.625400e-02 4.520060e-02 4.520060e-02 18 39
ucacuuaagaUGGUCACGGUAU
          | ::|||||||:
gggcccacggAGTGGTGCCATG
hsa-miR-548b-3p 16.0864 -11.03 5.843340e-02 5.675890e-02 5.462380e-03 261 282
uguuuucgUUGACUCCAAGAAc
        :| | :|||||||
gttttctgGAATCGGGTTCTTt
hsa-miR-152 16.059 -19.26 6.382950e-02 6.183510e-02 3.035570e-05 183 205
gguucaaGACAGU--ACGUGACU
       | ||||  |||||||:
cccccagCAGTCAGCTGCACTGG
hsa-miR-769-5p 15.9778 -29.5 8.191410e-02 7.864890e-02 8.393320e-03 67 88
ucgaGUCUUGGGUCUCCAGAgu
    ||||:|||| :|||||
cctgCAGAGCCCAAGGGTCTgc
mmu-miR-466d-3p 15.9497 -15.09 7.810520e-02 1.000000e-06 1.000000e-06 344 364
gAUACACACGCACAUACAUAU
 |:||||| | |  |||||||
aTGTGTGTACATACATGTATA
hsa-miR-557 15.9009 -24.75 7.111070e-02 6.864120e-02 6.344910e-03 320 345
ucuGUUCCGGG--UGG-GCACGUUUG
   ||: ||:|  ||| ||||||:|:
cacCAGAGCTCTGACCTCGTGCAGAT
hsa-miR-654-3p 15.8691 -19.87 6.165060e-02 5.978870e-02 3.214580e-04 232 257
UUCCACUAC--CAGUC--GUCUGUAu
|:||||: |  |  ||  |||||||
AGGGTGGGGCCGCAAGCTCAGACATc
mmu-miR-466a-3p 15.7928 -15.99 8.842110e-02 1.000000e-06 1.000000e-06 342 364
agaAUACACACGCACAUACAUAU
   |:||||| | |  |||||||
agaTGTGTGTACATACATGTATA
hsa-miR-767-5p 15.6846 -22.36 7.294210e-02 7.034530e-02 8.539100e-04 22 44
guacgagucuguUGGUACCACGU
            :||||||||:|
ccacggagtggtGCCATGGTGTA
bta-miR-148b 15.6517 -13.5 8.013700e-02 4.347220e-03 5.640760e-04 184 205
uguuucaagacaCUACGUGACU
            | |||||||:
ccccagcagtcaGCTGCACTGG
mmu-miR-466g 15.622 -14.99 7.525900e-02 1.000000e-06 1.000000e-06 355 375
acacACACGUACACAGACAUA
    ||| :|   ||||||:|
tacaTGTATACCCGTCTGTGT
hsa-miR-668 15.5764 -24.53 7.004470e-02 6.764790e-02 6.760900e-03 13 34
CAUCACCCGGCUCGGCUCACUGU
| || ||||| | | |||||:::
GAAGCGGGCCCA-CGGAGTGGTG
hsa-miR-675 15.4683 -23.97 8.777490e-02 8.403300e-02 1.093320e-04 136 161
gUGACACCCGGGA---GAGGCGUGGU
 :|||  ||| ||   | ||||||::
gGCTGGAGGCACTGACCACCGCACTG
bta-miR-148a 15.4343 -14.56 9.627230e-02 4.347220e-03 5.640760e-04 184 205
uguuucaagacaucACGUGACU
              |||||||:
ccccagcagtcagcTGCACTGG
hsa-miR-933 15.4343 -20.01 5.663190e-02 5.505820e-02 1.054950e-02 359 380
cccucuccagAGGGACGCGUGU
          ||: ||:|||||
tgtatacccgTCTGTGTGCACA
bta-miR-423 15.2897 -28.04 9.626430e-02 9.177610e-02 1.424720e-03 198 221
ugacucCCCGGAGUCUGGCUCGAa
      |||  |||||| |||||
tgcactGGGGATCAGACAGAGCTg
bta-miR-10a 15.2519 -22.43 9.265160e-02 8.848900e-02 6.974210e-04 113 132
GUGUUUAAGCCUAGAUGUCCCAU
||| |:  |||:   :|||||||
CACCAGCGCGGG---GCAGGGTA
hsa-miR-885-5p 15.1082 -16.81 8.490030e-02 3.406390e-03 3.406390e-03 28 49
UCUCCGUCCCAUCACAUUACCU
|| ||::   |:||||| |||:
AGTGGTGCCATGGTGTACTGGG
mmu-miR-878-3p 15.1082 -24.09 8.717730e-02 8.348540e-02 9.183970e-03 19 40
agauGGGUCACACCACAGUACg
    | |:| |||||| ||||
ggccCACGGAGTGGTGCCATGg
hsa-miR-937 14.5648 -22.52 9.940760e-02 9.462640e-02 8.472990e-04 100 125
CCGUCUC---UCAGU-CUCGCGCCUa
||| |:|   :| ||  |||||||:
GGCTGGGCCTGGCCACCAGCGCGGGg
Features
AFFY_Bovine Bt.23799.1.S1_at
EntrezGene 533202
RefSeq_dna_predicted XM_612529
RefSeq_peptide_predicted XP_612529
UniGene Bt.62229
spacer
spacer