spacer

Target Detailed View


Hit information for ENSBTAT00000029225

Gene Name LOC526028
Transcript ENSBTAT00000029225
Gene ENSBTAG00000021920
Description
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
bta-miR-34a 18.7636 -29.58 8.194820e-03 8.161330e-03 6.835140e-05 123 144
uGUUGGUCGAUUCUGUGACGGU
 | :|||||  :|:||||||||
tCTGCCAGCACGGGCACTGCCA
hsa-miR-297 18.6435 -24.58 1.235350e-02 3.384620e-03 3.384620e-03 304 324
GUACGUGUACGUGUGUAUGUA
::||||||| :::||:|||||
TGTGCACATATGTACGTACAT
gga-miR-460 18.2335 -24.79 1.009460e-02 1.004380e-02 6.374710e-03 280 301
GUGUGU-CACACAUGUUACGUCc
:|||:| ||||||: |||||||
TACATATGTGTGTG-AATGCAGa
mmu-miR-466a-5p 18.0215 -21.17 1.965210e-02 1.452950e-04 1.452950e-04 294 315
aUACAUGUACAUGUGUGUGUAU
 ||| | ||||:::||||:||:
aATGCAGATGTGTGCACATATG
mmu-miR-466e-5p 17.8095 -18.97 2.219320e-02 1.452950e-04 1.452950e-04 294 315
aUACAUGUACAUGUGUGUGUAg
 ||| | ||||:::||||:||
aATGCAGATGTGTGCACATATg
mmu-miR-466b-5p 17.8095 -18.87 2.216240e-02 1.452950e-04 1.452950e-04 294 315
gUACAUGUACAUGUGUGUGUAg
 ||| | ||||:::||||:||
aATGCAGATGTGTGCACATATg
mmu-miR-670 17.7035 -27.37 2.141930e-02 2.119150e-02 5.756010e-06 51 71
aaGUGGUGUAUGUGAGUCCCUa
  |||||  ||| ||||||||
ggCACCAGCTAC-CTCAGGGAc
bta-let-7b 17.5975 -24.7 2.514330e-02 2.514330e-02 2.946050e-08 44 66
uugGUGUGU-UGGAUGAUGGAGU
   |||| : ||| :||||||||
ttgCACAGGCACCAGCTACCTCA
mmu-miR-466c-5p 17.4915 -18.18 3.008110e-02 1.452950e-04 1.452950e-04 294 315
aUACAUGUACGUGUGUGUGUAg
 ||| | |||::::||||:||
aATGCAGATGTGTGCACATATg
hsa-miR-665 17.3487 -29.77 4.682060e-02 4.574140e-02 1.430830e-04 391 412
uccCCGGAGUC--GGAGGACCA
   ||||| :|  |||||||||
cttGGCCTGGGGTCCTCCTGGT
mmu-miR-466h 17.2795 -18.11 3.393590e-02 1.452950e-04 1.452950e-04 292 313
AUGUGUGUUCGUGUACGUGUGU
|: |::||: ::::||||||:|
TGAATGCAGATGTGTGCACATA
cfa-miR-449 17.1735 -27.42 3.432370e-02 3.374130e-02 1.152560e-03 122 144
uGGUCGAUUGU-UAUGUGACGGU
 :| || |:|| : :||||||||
cTCTGCCAGCACGGGCACTGCCA
mmu-miR-466f-3p 17.152 -20.01 3.264070e-02 1.452950e-04 1.452950e-04 263 283
cACACAUACACACACACAUac
 |||| :||||| ||||||
aTGTGGGTGTGTTTGTGTAca
mmu-miR-351 17.1215 -29.35 3.995710e-02 3.916930e-02 4.160660e-05 49 70
GUCCGAGUUUCCCGAGGAGUCCCU
||||| | |  | : |||||||||
CAGGCACCA--GCTACCTCAGGGA
hsa-miR-453 17.0929 -26.45 2.262980e-02 2.237570e-02 2.237570e-02 65 87
acgCUUGAGUGGUGCCUGUUGGA
   |:|| :: |::||:||||||
cagGGACATGGCGTGGGCAACCT
mmu-miR-466d-5p 17.0674 -21.76 3.655070e-02 1.452950e-04 1.452950e-04 294 315
gUACAUGUACAUGCGUGUGUGU
 ||| | ||||::|||||:|::
aATGCAGATGTGTGCACATATG
bta-let-7c 17.0674 -21.22 3.938250e-02 3.938250e-02 2.946050e-08 46 66
uugGUAUGUUGGAUGAUGGAGU
   || :| ||| :||||||||
gcaCAGGC-ACCAGCTACCTCA
hsa-miR-615-5p 16.9614 -29.47 6.834200e-02 6.605900e-02 8.855810e-04 208 230
CUAGGCUC-GUGGCCCCUGGGGg
||||  || ::|  ||||||||
GATCACAGATGCGTGGGACCCCa
hsa-miR-657 16.8819 -24.06 3.569250e-02 4.023790e-03 6.387090e-04 67 90
ggaUCUCUCCCACUC-UUGGACGG
   | | :| |||:| |||||||:
gggACATGGCGTGGGCAACCTGCT
bta-let-7a 16.8554 -19.34 4.605420e-02 4.605420e-02 2.946050e-08 45 66
uugauauguUGGAUGAUGGAGU
         ||| :||||||||
tgcacaggcACCAGCTACCTCA
bta-miR-138 16.7764 -25.73 4.582300e-02 1.226980e-03 3.391750e-05 147 172
GCCGGACUAAGUG---UUGUGGUCGa
:||: ||: |:||   ::|||||||
TGGTGTGGCTTACCAGGGCACCAGCc
bta-miR-205 16.7494 -18 3.745280e-02 3.676010e-02 2.409370e-05 413 434
gUCUGAGGCCACCUUACUUCCU
 :| | ::|| |  |||||||:
gGGTCATTGGAGCTATGAAGGG
hsa-miR-543 16.7494 -14.93 2.733190e-02 2.696180e-02 1.161530e-03 571 592
uucuucaCGUGGCGCUUACAAA
       | :|: |||||||||
gctcccaGGGCTACGAATGTTT
bta-miR-138 16.6709 -25.75 5.037450e-02 1.226980e-03 3.391750e-05 37 60
gccGGACUAAGUGU-UGUGGUCGA
   | |  | |||| :||||||||
ctaCGTTTTGCACAGGCACCAGCT
mmu-miR-466f-5p 16.6434 -25.19 3.460500e-02 1.452950e-04 1.452950e-04 294 317
gUACG--UGUACGUGUGUGUGCAU
 ||||  |::||::||||:|:|||
aATGCAGATGTGTGCACATATGTA
hsa-miR-362-3p 16.6434 -17.14 2.906870e-02 2.865030e-02 7.725270e-04 253 275
acUUAGGAACU-UAUCCACACAA
  |:|:   || :|:||||||||
gaAGTTGCAGATGTGGGTGTGTT
hsa-miR-662 16.6194 -24.46 3.127810e-02 1.783490e-03 6.481380e-04 62 82
gacGACCCGGUGUUGCACCCu
   | ||| ||:::||||||
cctCAGGGACATGGCGTGGGc
hsa-miR-874 16.5374 -23.37 6.509650e-02 6.302300e-02 6.543240e-03 146 167
AGCCAGGGAGCCCGGUCCCGUc
|:||| :  |   ||||||||
TTGGTGTGGCTTACCAGGGCAc
hsa-miR-329 16.5374 -13.99 3.207570e-02 3.156670e-02 9.134420e-03 253 275
UUUCUCCAAUUG-GUCCACACAA
:|||  |  :|: ::||||||||
GAAGTTGCAGATGTGGGTGTGTT
bta-let-7i 16.5374 -24.22 6.340240e-02 6.340240e-02 2.946050e-08 42 66
uuguCGUGUUU---GAUGAUGGAGU
    |||||::   | :||||||||
ttttGCACAGGCACCAGCTACCTCA
mmu-miR-466g 16.5128 -23.25 3.575880e-02 1.452950e-04 1.452950e-04 260 280
acacACACGUACACAGACAUA
    |||| :|||||:|||:|
cagaTGTGGGTGTGTTTGTGT
hsa-miR-298 16.4913 -26.36 7.956850e-02 7.648520e-02 1.102200e-03 358 381
acccucUUGGAGGGACGAAGACGa
      |::||:||||:|||||:
agatgcAGTCTTCCTGTTTCTGTc
bta-let-7g 16.4314 -21.16 6.467760e-02 6.467760e-02 2.946050e-08 42 66
uuGACAUGUUU---GAUGAUGGAGU
  :|| |||::   | :||||||||
ttTTGCACAGGCACCAGCTACCTCA
bta-let-7e 16.4063 -18.08 7.883300e-02 7.883300e-02 2.946050e-08 46 66
ugauauguUGGAGGAUGGAGU
        |||  ||||||||
gcacaggcACCAGCTACCTCA
mmu-miR-681 16.4063 -26.16 4.511680e-02 4.411420e-02 4.411420e-02 184 205
UCGACGGACG-GUCGCUCCGAC
| || ||| | | |:|||||||
ACCTTCCTCCTCTGTGAGGCTG
mmu-miR-466f-5p 16.3254 -19.42 4.544930e-02 1.452950e-04 1.452950e-04 268 289
gUACGUGUACGUGUGUGUGCAU
 :||::: ||:::|||:|:||:
gGTGTGTTTGTGTACATATGTG
bta-let-7d 16.3254 -18.98 7.282850e-02 7.282850e-02 2.946050e-08 45 66
uugauacguUGGAUGAUGGAGa
         ||| :|||||||
tgcacaggcACCAGCTACCTCa
hsa-miR-875-3p 16.2998 -19.47 8.694430e-02 8.327180e-02 8.798580e-03 576 597
GUGUUGGAG-UCACAAAGGUCC
|| ::|: | | |||||:||||
CAGGGCTACGAATGTTTTCAGG
mmu-miR-699 16.2778 -22.25 6.325840e-02 6.129910e-02 1.181140e-02 123 144
gcuCGGUCCAG--CGUGACGGa
   |||||  |  ||||||||
tctGCCAGCACGGGCACTGCCa
bta-miR-98 16.2194 -18.12 8.163030e-02 7.838740e-02 1.870090e-06 45 66
uUGUUAUGUUGAAUGAUGGAGU
 :||  :  ||  :||||||||
tGCACAGGCACCAGCTACCTCA
hsa-miR-297 16.1932 -15.78 8.462070e-02 3.384620e-03 3.384620e-03 268 288
gUACGUGUACGUGUGUAUGUA
 :||::: ||:::|||||::|
gGTGTGTTTGTGTACATATGT
mmu-miR-466d-3p 16.1932 -16.12 6.666510e-02 1.452950e-04 1.452950e-04 271 291
gAUACACACGCACAUACAUAU
 |:| ||||:   |||||:|:
gTGTTTGTGTACATATGTGTG
hsa-miR-520h 16.1134 -18.37 6.652820e-02 6.652820e-02 3.598010e-03 431 455
ugagaUUUCCCU---UCGUGAAACa
     ||:||||   | |||||||
aggggAAGGGGACGCATCACTTTGc
mmu-miR-466d-3p 16.0867 -16.81 7.145670e-02 1.452950e-04 1.452950e-04 299 319
gaUACACACGCACAUACAUau
  ||||||||   ||||||
agATGTGTGCACATATGTAcg
bta-miR-125a 16.0378 -25.12 7.140000e-02 7.140000e-02 2.933910e-05 47 70
GUGUCCAAUUUC-CCAGAGUCCCU
||||||    ||    ||||||||
CACAGGCACCAGCTACCTCAGGGA
mmu-miR-466a-3p 16.0378 -18.93 7.561080e-02 1.452950e-04 1.452950e-04 269 291
agaAUACACACGCACAUACAUAU
   |:| ||||:   |||||:|:
gtgTGTTTGTGTACATATGTGTG
mmu-miR-466a-5p 16.0074 -16.58 9.788940e-02 1.452950e-04 1.452950e-04 266 287
AUACAUGUACAUGUGUGUGUAU
|: ||:::| |::::|||:||:
TGGGTGTGTTTGTGTACATATG
bta-let-7f 16.0074 -16.59 9.700070e-02 9.244460e-02 2.946050e-08 45 66
uugauauguUAGAUGAUGGAGU
         | | :||||||||
tgcacaggcACCAGCTACCTCA
hsa-miR-520g 15.9661 -20.4 8.042710e-02 7.727780e-02 3.598010e-03 429 455
ugugagaUUUCCCU---UCGUGAAACa
       ||:||||   | |||||||
gaaggggAAGGGGACGCATCACTTTGc
mmu-miR-466a-3p 15.9323 -17.51 8.089320e-02 1.452950e-04 1.452950e-04 297 319
agaaUACACACGCACAUACAUau
    ||||||||   ||||||
gcagATGTGTGCACATATGTAcg
hsa-miR-550 15.9323 -23.77 8.031630e-02 7.717560e-02 1.639270e-04 30 56
cCCGA-GAAUGAGGGA---GUCCGUGa
 |||| | ||| :::|   |||||||
tGGCTCCCTACGTTTTGCACAGGCACc
mmu-miR-466b-3-3p 15.9323 -17.51 8.166010e-02 1.452950e-04 1.452950e-04 297 319
agaaUACACACGCACAUACAUaa
    ||||||||   ||||||
gcagATGTGTGCACATATGTAcg
bta-miR-18b 15.9013 -18.15 7.109740e-02 7.109740e-02 3.633780e-02 168 189
aUUGACGUGAUCUACGUGGAAu
 |:|  ::| : : |||||||
cAGCCTTGCAGAGGGCACCTTc
hsa-miR-657 15.8268 -23.13 9.250660e-02 4.023790e-03 6.387090e-04 101 123
ggaucucucccACUCUUGGACGG
           ||||:||||||:
ccgcccggccaTGAGGACCTGCT
mmu-miR-466b-3-3p 15.8268 -16.8 8.737060e-02 1.452950e-04 1.452950e-04 269 291
agaAUACACACGCACAUACAUAa
   |:| ||||:   |||||:|
gtgTGTTTGTGTACATATGTGTg
bta-miR-125b 15.7953 -19.24 8.507030e-02 8.155230e-02 2.933910e-05 52 70
aGUGUUCAAUCCCAGAGUCCCU
 ||| || ||    ||||||||
gCACCAGCTA---CCTCAGGGA
hsa-miR-662 15.7671 -29.05 6.094680e-02 1.783490e-03 6.481380e-04 203 225
GACGACCCGGUGU---UGCACCCU
||| ||| :||||   :|||||||
CTG-TGGATCACAGATGCGTGGGA
bta-miR-10b 15.7213 -20.56 5.186610e-02 5.186610e-02 9.710780e-03 501 523
gugUUUAAGCCAAGAUGUCCCAU
   ::: | ||||  :||||||:
atgGGGGTGGGTTGGGCAGGGTG
bta-miR-19a 15.7213 -14.06 9.255890e-02 9.213900e-02 1.895810e-04 27 50
agucaaaACGUAU-CUAAACGUGU
       | | || | ||||||||
gcatggcTCCCTACGTTTTGCACA
hsa-miR-600 15.7213 -16.87 7.317850e-02 7.056510e-02 2.622820e-02 180 202
CUCGUUCCGAGAACAGACAUUCa
|:|||   : ||  |||||:||
GGGCACCTTCCTCCTCTGTGAGg
mmu-miR-693-5p 15.6605 -16.42 7.330050e-02 3.028110e-03 3.028110e-03 137 157
cuuuugaaagcCUACACCGAc
           |:|||||||
cactgccacttGGTGTGGCTt
hsa-miR-603 15.5833 -20.29 8.937090e-02 8.549370e-02 3.413700e-02 250 275
CGUUUUCA---UUAACG-UCACACAc
|||:||||   |: ||: :||||||
GCAGAAGTTGCAGATGTGGGTGTGTt
bta-miR-18a 15.5833 -18.28 9.373180e-02 8.947310e-02 3.633780e-02 170 189
auaGACGUGAUCUACGUGGAAu
   :||||  ||: |||||||
gccTTGCA-GAGG-GCACCTTc
mmu-miR-693-5p 15.554 -17.57 7.991550e-02 3.028110e-03 3.028110e-03 251 271
cUUUUGAAAGCCUACACCGAC
 |:|| || | ||||||| ||
cAGAAGTTGCAGATGTGGGTG
mmu-miR-707 15.554 -18.88 7.142090e-02 6.893010e-02 1.055160e-02 15 35
gcauccGUUCGCCGUACUGAc
      :::| ||||||:||
gcagccTGGGAGGCATGGCTc
bta-miR-19b 15.5102 -13.92 9.666400e-02 9.213900e-02 1.895810e-04 28 50
agucaaaacguacCUAAACGUGU
             | ||||||||
catggctccctacGTTTTGCACA
bta-miR-10a 15.2992 -24.01 8.889820e-02 8.506130e-02 9.710780e-03 500 523
GUGUUUAAGCCUAG-AUGUCCCAU
:|::::  :||:|:  :||||||:
TATGGGGGTGGGTTGGGCAGGGTG
hsa-miR-933 14.9473 -20.16 8.687520e-02 8.320850e-02 3.289020e-02 262 283
cccucUCCAGAGGGACGCGUGU
     :||| | ::||:|:|||
gatgtGGGTGTGTTTGTGTACA
hsa-miR-521 14.7352 -10.49 8.824710e-02 8.446540e-02 9.040280e-03 254 275
UGUGAGAUUUCCCUUCACGCAA
| ::|  |:| | ::|||:|||
AAGTTGCAGATGTGGGTGTGTT
hsa-miR-937 14.7352 -22.65 8.810360e-02 8.433400e-02 1.116100e-03 61 82
ccgucUCUCAGUCUCGCGCCUa
     ||:| || :|||:||:
acctcAGGGACATGGCGTGGGc
hsa-miR-100 14.5232 -14.78 7.068350e-02 6.824330e-02 3.807800e-03 251 271
GUGUUCAAGCCUAGAUGCCCAa
|| ||||| | |  |::||||
CAGAAGTT-GCAGATGTGGGTg
Features
EntrezGene 526028
GO GO:0005515
RefSeq_dna_predicted XM_604387
RefSeq_peptide_predicted XP_604387
UniGene Bt.48694
spacer
spacer