spacer

Target Detailed View


Hit information for ENSBTAT00000027060

Gene Name LOC533554
Transcript ENSBTAT00000027060
Gene ENSBTAG00000020303
Description
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
hsa-miR-593 18.5872 -25.42 1.462430e-02 1.451790e-02 7.954660e-03 57 74
UCUUUGGGGUCGUCUCUGu
| ||:||||| |||||||
ACAAGCCCCA-CAGAGACt
hsa-miR-568 18.1497 -9.4 2.537600e-02 1.581440e-03 9.971350e-10 202 221
cacacaUAUGUAAAUAUGUa
      |||::||||||||
tatatcATATGTTTATACAa
hsa-miR-888 18.0522 -14.79 1.091660e-02 1.085720e-02 7.040480e-06 384 404
acugacUGUCGAAAAACUCAU
      | |||| ||||||||
tcgagcAAAGCTGTTTGAGTA
mmu-miR-710 17.7412 -24.73 1.771510e-02 1.755910e-02 1.712130e-03 56 77
gaGUUGAGAGGGGUUCUGAACC
  |||  | | | :||||||||
aaCAAGCCCCACAGAGACTTGG
bta-miR-15b 17.7412 -22.1 2.476810e-02 2.476810e-02 2.476810e-02 18 39
acauUUGGUACUACACGACGAU
    ::||  |: |||||||||
agctGGCCTGGGAGTGCTGCTA
hsa-miR-421 17.6552 -12.93 1.434550e-02 1.424310e-02 4.997410e-05 394 415
cGCGGGUUAAUUACAGACAACUa
 :|::::| |||  ||||||||
cTGTTTGAGTAA-ATCTGTTGAa
mmu-miR-763 17.6317 -21.55 2.436830e-02 1.496000e-03 1.165910e-03 33 54
CGGUGACCAAGAAGGGUCGACc
||::|| |  |  :|||||||
GCTGCTAGGGCCCTCCAGCTGc
bta-miR-497 17.6317 -18.49 3.090060e-02 3.042810e-02 3.042810e-02 18 39
aUGUUUGGUGUCACACGACGAc
 :| ::||  :| ||||||||
aGCTGGCCTGGGAGTGCTGCTa
bta-miR-15a 17.3917 -18.94 3.243570e-02 3.191530e-02 3.191530e-02 19 39
UGUUUGGUAAUACACGACGAU
:| ::||   : |||||||||
GCTGGCCTGGGAGTGCTGCTA
bta-miR-16 17.3917 -18.69 3.010640e-02 2.965770e-02 2.965770e-02 19 39
CGGUUAUAAAUGCACGACGAU
||:::  |  : |||||||||
GCTGGCCTGGGAGTGCTGCTA
bta-let-7a* 17.3917 -6.3 2.666550e-02 2.631310e-02 2.515680e-04 130 149
CUUUCUGUCAUCUAACAUAUc
|:|| |: | || |||||||
GGAACATTGAAG-TTGTATAc
bta-miR-19a 17.3283 -17.62 2.611010e-02 2.611010e-02 3.150350e-06 140 162
agucaAAACGUAUCUAAACGUGU
     | | || |||||||:|||
agttgTATACAAAGATTTGTACA
hsa-miR-95 17.3031 -16.66 1.057010e-02 1.051440e-02 4.140330e-06 395 415
ACGAGUUAUUUAUGGGCAACUU
||:|::|  || |:|:||||||
TGTTTGAGTAA-ATCTGTTGAA
hsa-miR-556-5p 17.0841 -14.46 2.284730e-02 2.258830e-02 1.050880e-02 252 273
gaguaUAAUGUUACUCGAGUAG
     |||: || |||:||||:
aggtaATTGGAAAGAGTTCATT
bta-miR-24 17.0841 -18.54 4.651910e-02 4.545370e-02 8.928300e-03 304 325
gACAAGGACGACUUGACUCGGu
 | |  || :| ::|||||||
gTATCACTTTTTGGCTGAGCCc
bta-miR-320 16.9746 -18.16 4.679010e-02 4.571230e-02 4.571230e-02 181 203
agcGGGAGAGUUG-GGUCGAAAa
   |:: || |:: ||||||||
ataCTTCCTAAGTACCAGCTTTa
mmu-miR-466h 16.9746 -17.04 4.387370e-02 4.292520e-02 8.364870e-05 143 164
AUGUGUGUUCGUGUACGUGUGU
|::|:||||  |: ||:|||:|
TGTATACAAAGATTTGTACATA
cfa-miR-449 16.9746 -18.51 4.130050e-02 4.045930e-02 4.045930e-02 336 356
uggucGAUUGUUAUGUGACGGU
     :|||:||| |||||:||
tattcTTAATAAT-CACTGTCA
hsa-miR-506 16.9514 -12.3 2.516990e-02 2.485580e-02 6.532250e-05 357 377
AGAUGAGUCUUCCCACGGAAu
||  ||:| |   |||||||
TCCCCTTAAATCTGTGCCTTt
hsa-miR-568 16.9323 -13.73 5.732180e-02 1.581440e-03 9.971350e-10 144 163
CACACAUAUGUAAAUAUGUA
|| |  | | ||||:|||||
GTATACAAAGATTTGTACAT
bta-miR-205 16.8651 -12.03 3.378790e-02 3.322350e-02 2.672460e-04 230 251
gUCUGAGGCCACCUUACUUCCu
 | | |:|  |  ||||||||
aAAAGTTCATTTTAATGAAGGc
hsa-miR-935 16.7834 -20.68 1.941720e-02 1.922990e-02 1.922990e-02 238 261
cgccAUCGCCUUCG-CCAUUGACC
    || :| |:|| |||||:|||
atttTAATGAAGGCAGGTAATTGG
mmu-miR-763 16.646 -26.18 5.572230e-02 1.496000e-03 1.165910e-03 2 23
cggugaccAAGAAGGGUCGACC
        |||| :|:||||||
tggccctcTTCTCTCTAGCTGG
hsa-miR-371-5p 16.4896 -14.16 3.699960e-02 3.632350e-02 8.849210e-05 384 403
ucacgggggUGUCAAACUCA
         :| ||||||||
tcgagcaaaGCTGTTTGAGT
bta-miR-19b 16.4564 -15.21 4.543390e-02 4.441720e-02 3.150350e-06 140 162
agucaAAACGUACCUAAACGUGU
     | | ||  ||||||:|||
agttgTATACAAAGATTTGTACA
bta-miR-30e-5p 16.3804 -15.73 5.839940e-02 5.839940e-02 4.277910e-03 197 218
UCGAAGGUCAGUUCCUACAAAUGU
|||||:   |||   |||||||:|
AGCTTTATATCA--TATGTTTATA
hsa-miR-219-2-3p 16.3175 -11.52 5.438960e-02 5.293690e-02 1.000710e-02 206 225
uGUCUACAGGUCGGUGUUAAGa
 || ||||::|  :||||||:
tCATATGTTTA--TACAATTTa
hsa-miR-627 16.3175 -12.14 4.922800e-02 4.803590e-02 4.803590e-02 274 295
AGGAGAAAAGAAUCUCUGAGUg
|: |:  ||:||  |||||:|
TTGTTCATTTTTCCAGACTTAg
hsa-miR-340 16.3175 -9.99 9.827370e-02 9.359920e-02 1.723660e-02 187 206
uuAGUCAGAGUAACGAAAUAUu
  | |||  ||  ||||||||
ccTAAGTACCA--GCTTTATAt
hsa-miR-520g 16.272 -12.33 6.195740e-02 6.195740e-02 1.141690e-02 254 277
UGUGAGAUUUCCCUUCGUGAAACA
::| |: :|| | :  ||:|||||
GTAATTGGAAAGAGTTCATTTTGT
hsa-miR-328 16.0985 -23.27 9.579440e-02 9.134920e-02 2.158310e-02 25 46
uGCCUUCCCGUCUCUCCCGGuc
 :||:|| || |  ||||||
cTGGGAGTGCTGCTAGGGCCct
bta-miR-107 16.0985 -22.35 7.452820e-02 7.181870e-02 1.062770e-02 18 38
cuauCGGGACAUGUUACGACGA
    | |||| : |:|||||||
agctGGCCTG-GGAGTGCTGCT
mmu-miR-292-5p 16.0985 -16.05 5.679450e-02 5.521180e-02 3.278310e-04 382 403
guuuucucggggGUCAAACUCA
            | ||||||||
tctcgagcaaagCTGTTTGAGT
hsa-miR-576-5p 16.0985 -12.65 6.514370e-02 6.306720e-02 1.740690e-03 243 264
UUUCUGCACCUCUUUAAUCUUa
|| || |   :| ||||:|||
AATGAAGGCAGGTAATTGGAAa
bta-miR-30b 16.0985 -10.31 5.773970e-02 5.773970e-02 4.277910e-03 197 218
UCGACUCACAUCCUACAAAUGU
||||   | |   |||||||:|
AGCTTTATATCATATGTTTATA
hsa-miR-575 16.0273 -23.48 6.804440e-02 6.578100e-02 5.905980e-03 8 26
cGAGGACAGGUUGACCGag
 ||:|| ||:|:|||||
tCTTCTCTCTAGCTGGCct
hsa-miR-516a-5p 16.0205 -20.03 4.202370e-02 4.115290e-02 2.217050e-02 366 390
cuuuCACGAAGAAAG--GAGCUCuu
    |||| |:||||  ||||||
atctGTGCCTTTTTCTTCTCGAGca
bta-miR-103 16.0205 -23.17 8.252820e-02 7.921450e-02 1.258600e-02 17 38
aguauCGGGACAUGUUACGACGA
     | |||| : |:|||||||
tagctGGCCTG-GGAGTGCTGCT
mmu-miR-669a 15.989 -13.79 9.653200e-02 9.201920e-02 4.521090e-04 203 223
UGUACUUGUACGUGUGUGUUGA
|:||  |:|||: :|:||||:|
ATAT-CATATGTTTATACAATT
hsa-miR-520h 15.989 -12.13 7.405410e-02 7.137850e-02 1.141690e-02 256 277
UGAGAUUUCCCUUCGUGAAACA
| |: :|| | :  ||:|||||
AATTGGAAAGAGTTCATTTTGT
hsa-miR-615-3p 15.8795 -30.36 6.773050e-02 6.548770e-02 9.354460e-06 86 107
UUCUCCCUCUGGGUCCGAGccu
||  |||||:||::|||||
AATTGGGAGGCCTGGGCTCatt
mmu-miR-290-5p 15.8795 -13.3 6.099970e-02 5.917650e-02 1.334270e-03 382 403
uuucacggggguauCAAACUCA
              ||||||||
tctcgagcaaagctGTTTGAGT
hsa-miR-337-5p 15.8507 -14.93 3.581770e-02 3.518380e-02 2.094380e-03 379 399
uuGAGGACAUACUUCGGCAAG
  :||: | :  ||||:|||:
tcTTCTCGAGCAAAGCTGTTT
mmu-miR-547 15.6305 -13.34 7.293520e-02 7.033890e-02 1.419610e-02 111 131
gagugAGUUUCUACAUGGUUC
     | :|| |||||:||:|
gtgtaTAGAAAATGTATCAGG
bta-miR-30a-5p 15.6211 -13.17 8.884580e-02 8.501330e-02 4.277910e-03 197 218
UCGAAGGUCAGCUCCUACAAAUGU
|||||:   || |  |||||||:|
AGCTTTATATC-A-TATGTTTATA
hsa-miR-564 15.5821 -16.29 9.125580e-02 8.721580e-02 1.912690e-02 357 375
cGGACGACUGUGGCACGGA
 ||  :| |  |:||||||
tCCCCTTAAATCTGTGCCT
hsa-miR-216b 15.5509 -7.93 9.582230e-02 9.137450e-02 9.163860e-05 136 157
AGUGUAAACGGACGUCUCUAAA
|:: | |||: | || ||||||
TTGAAGTTGTATACAAAGATTT
hsa-miR-410 15.5205 -14.7 8.188220e-02 7.861950e-02 2.782070e-03 127 148
uGUCC-GGUAGACACAAUAUAa
 ||||  |||:   |||:|||
tCAGGAACATTGAAGTTGTATa
bta-miR-30d 15.5126 -13.17 8.304130e-02 8.304130e-02 4.277910e-03 197 218
UCGAAGGUCAGCCCCUACAAAUGU
|||||:   ||    |||||||:|
AGCTTTATATC--ATATGTTTATA
bta-miR-150 15.4756 -18.58 9.954350e-02 9.474940e-02 8.426280e-04 73 95
ugugaccauguucccAACCCUCU
               |||||||:
cttgggggtgttcaaTTGGGAGG
bta-miR-29a 15.2576 -19.43 7.639580e-02 7.355060e-02 1.107370e-02 17 40
AUUGGCUAAAGUCU-ACCACGAUC
||:|:|:  | :|| || ||||||
TAGCTGGCCTGGGAGTGCTGCTAG
bta-miR-191 14.8217 -20.39 9.922080e-02 9.445730e-02 2.031450e-02 391 413
gUCGACGAAAACCCUAAGGCAAC
 |||||:||  |  | ||:||||
aAGCTGTTTGAGTAAATCTGTTG
Features
AFFY_Bovine Bt.10195.1.S1_at
EntrezGene 533554
RefSeq_dna_predicted XM_612994
RefSeq_peptide_predicted XP_612994
UniGene Bt.82082
spacer
spacer