spacer

Target Detailed View


Hit information for ENSBTAT00000026257

Gene Name LOC614049
Transcript ENSBTAT00000026257
Gene ENSBTAG00000019697
Description
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
bta-miR-19b 18.332 -14.57 9.815300e-03 9.815300e-03 1.564280e-06 478 500
AGUCAAAACGUACCUAAACGUGU
||: || ||: |  |||||||||
TCGTTTCTGTCTTAATTTGCACA
bta-miR-19a 18.332 -15.04 1.167450e-02 1.160660e-02 1.564280e-06 478 500
AGUCAAAACGUAUCUAAACGUGU
||: || ||: |  |||||||||
TCGTTTCTGTCTTAATTTGCACA
hsa-miR-485-5p 17.3597 -26.93 3.497820e-02 3.437350e-02 6.457800e-03 335 357
cuuaaGUAGUGCC-GGUCGGAGA
     || |::|| |||||||||
cctccCAGCGTGGACCAGCCTCT
mmu-miR-467a 17.0422 -17.2 2.020490e-02 2.000210e-02 1.946300e-04 509 529
gCGUAUAUGUACGUCCGUGAAu
 | | ||| | |:||||||||
aGGAGATA-ACGTAGGCACTTt
bta-miR-122 16.8305 -18.1 3.385120e-02 3.328470e-02 9.626270e-04 214 235
GUUUGUGGUAACAGUGUGAGGU
:: :| :||| | |||||||:|
TGTGCTTCATAGCCACACTCTA
hsa-miR-519d 16.8305 -12.74 2.614540e-02 2.614540e-02 2.424610e-06 509 530
gugagauUUCCCUCCGUGAAAc
       || | |||||||||
aggagatAACGTAGGCACTTTc
hsa-miR-574-5p 16.7517 -18.48 6.358300e-02 6.160380e-02 1.383500e-02 213 234
uGUGUGAGUGUGUGUGUGUGAGu
 ::::||: ||:|  |||||||
cTGTGCTT-CATAGCCACACTCt
bta-miR-106 16.7246 -16.25 4.490680e-02 4.391340e-02 1.410020e-03 509 530
auggacGUGACAUUCGUGAAAa
      :|  |||:|||||||
aggagaTAACGTAGGCACTTTc
mmu-miR-434-3p 16.6188 -27.1 2.148840e-02 2.125920e-02 2.125920e-02 67 90
UCCUCAG-CUCAC-UACCAAGUUU
||||||: |:| | | ||||:|||
AGGAGTTGGGGAGAAGGGTTTAAA
bta-miR-17-5p 16.572 -15.87 5.260130e-02 5.124180e-02 1.308490e-03 507 530
ugauggacGUGACAUUCGUGAAAc
        :|  |||:|||||||
caaggagaTAACGTAGGCACTTTc
mmu-miR-692 16.3819 -16.3 7.390490e-02 7.124000e-02 8.450960e-04 495 515
cucacUCCGCGAGUUUCUCUA
     || :|| |||:|||||
tgcacAGCTGCACAAGGAGAT
bta-miR-20a 16.3302 -13.91 7.244140e-02 7.244140e-02 1.265380e-03 508 530
gauggacGUGAUAUUCGUGAAAu
       :|  :||:|||||||
aaggagaTAACGTAGGCACTTTc
hsa-miR-519e 16.3012 -13.82 4.813050e-02 4.699060e-02 2.424610e-06 507 528
uugugagauUUUCCUCCGUGAA
         || | ||||||||
caaggagatAACGTAGGCACTT
mmu-miR-290-3p 16.2573 -16.06 3.640970e-02 3.575480e-02 4.956560e-03 505 529
cccgaaUUUUGAUCCG-CCGUGAAA
      :|:|: | |: ||||||||
cacaagGAGATAACGTAGGCACTTT
hsa-miR-609 16.2535 -19.76 6.037020e-02 5.858400e-02 4.206380e-03 404 423
ucucuACUCUCUUUGUGGGa
     | :|||||:|||||
tttccTCGGAGAAGCACCCg
mmu-miR-294 16.0895 -11.66 7.274430e-02 7.016140e-02 8.521880e-05 508 529
UGUGUGUUUUCCCUUCGUGAAA
| : | | || | |:|||||||
AAGGAGATAACGTAGGCACTTT
hsa-miR-515-3p 15.9837 -14.53 7.413260e-02 7.145140e-02 8.661510e-06 507 528
uugcgagguUUUCUUCCGUGAG
         || | |||||||:
caaggagatAACGTAGGCACTT
bta-miR-20b 15.8778 -12.49 7.814950e-02 7.517380e-02 1.265380e-03 509 530
auggacGUGACACUCGUGAAAc
      :|  || :|||||||
aggagaTAACGTAGGCACTTTc
hsa-miR-219-5p 15.85 -11.68 3.592340e-02 3.528580e-02 3.528580e-02 460 480
ucuUAACGCAAACCUGUUAGU
   ||| :|||| ||::|||:
ctcATTATGTTTAGATGATCG
hsa-miR-520e 15.85 -11.13 9.887920e-02 9.414790e-02 6.411300e-07 509 529
gggagUUUUUCCUUCGUGAAA
     | || | |:|||||||
aggagATAACGTAGGCACTTT
mmu-miR-291a-3p 15.772 -12.29 9.211800e-02 8.800250e-02 1.131780e-03 510 529
CGUGUGUUUCACCUUCGUGAAA
| | |:|| ||  |:|||||||
GGAGATAACGT--AGGCACTTT
mmu-miR-292-3p 15.7329 -15.08 7.107460e-02 6.860760e-02 8.282320e-04 506 529
UGUGAGUUUUGGACCGCCGUGAAA
|||   |:|    |  ||||||||
ACAAGGAGATAACGTAGGCACTTT
mml-miR-189 15.4874 -17.97 6.886140e-02 6.654400e-02 6.956730e-03 503 526
ugacuauagUCGAGU-CAUCCGUG
         || | | ||||||||
tgcacaaggAGATAACGTAGGCAC
hsa-miR-409-5p 15.382 -16.8 5.961390e-02 5.787180e-02 2.305980e-04 123 147
uACGUUUCAACGAGC--CCAUUGGa
 | ||:|| | || |  |||:|||
tTTCAGAGCTCCTGGGTGGTGACCa
hsa-miR-560 14.6495 -18.51 7.021140e-02 6.780330e-02 6.360200e-04 95 114
ccgccggccGGCCGCGUGCG
         :| |:||||||
accccaactTCCGTGCACGC
mmu-miR-341 14.0416 -23.39 9.965600e-02 9.485130e-02 1.065200e-02 241 261
uggcuGGCUGGCUAGCUGGCu
     | ||| || ||||||
ataccCAGACGGACCGACCGc
Features
EntrezGene 614049
GO GO:0042745
GO GO:0045475
RefSeq_dna_predicted XM_865373
RefSeq_peptide_predicted XP_870466
UniGene Bt.55456
spacer
spacer