spacer

Target Detailed View


Hit information for ENSBTAT00000025012

Gene Name LOC540646
Transcript ENSBTAT00000025012
Gene ENSBTAG00000018789
Description
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
mmu-miR-466f-3p 18.8799 -15.72 1.029560e-02 1.000000e-06 1.362680e-10 306 326
CACACAUACACACACACAUAC
|| | ||| | ||||||||||
GTCTTTATATATGTGTGTATG
hsa-miR-520a-3p 18.0484 -19.46 1.063140e-02 1.155520e-04 1.155520e-04 379 400
UGUCAGGUUUCCCUUCGUGAAA
| || ||| || ||||||:|||
AAAGCCCACAGTGAAGCATTTT
hsa-miR-424 17.7317 -19.58 2.856660e-02 2.816240e-02 2.816240e-02 190 211
aAGUUUUGUACUUAACGACGAc
 |||:|: ||||: |||||:|
cTCAGAGAATGAGATGCTGTTa
mmu-miR-466d-5p 17.6262 -15.81 2.322290e-02 1.000000e-06 1.362680e-10 323 344
GUACAUGUACAUGCGUGUGUGu
:||| | ||  | ||||||||
TATGGAGATACAAGCACACACc
bta-miR-484 17.5206 -30.15 3.111410e-02 3.063500e-02 1.013050e-03 224 246
uaGCCCUC-CCCUGACUCGGACU
  :| ||| ||||  ||||||||
cgTGTGAGAGGGAGCGAGCCTGA
hsa-miR-543 17.5206 -21.33 1.363840e-02 1.354580e-02 1.354580e-02 108 129
uucuucaCGUGGCGCUUACAAA
       | ||:|:||||||||
tgttgagGAACTGTGAATGTTT
hsa-miR-617 17.5206 -23.23 1.529030e-02 1.517400e-02 1.383550e-04 22 43
cGGUGGAAGUUUACCCUUCAGA
 |: :|  |:: ||||||||||
tCTCTCCCCGGTTGGGAAGTCT
hsa-miR-520d-5p 17.4854 -16.25 2.534080e-02 1.155520e-04 1.155520e-04 437 457
CUUUCCCG-AAGGGAAACAUc
||||   | |||||||||||
GAAATACCATTCCCTTTGTAt
mmu-miR-322 17.4151 -19.66 3.741530e-02 3.672400e-02 3.672400e-02 190 211
aGGUUUUGUACUUAACGACGAc
 :||:|: ||||: |||||:|
cTCAGAGAATGAGATGCTGTTa
hsa-miR-410 17.3949 -22.71 2.029480e-02 2.009020e-02 1.587470e-02 167 188
UGUCCGGUAG-ACACAAUAUAa
:|||| ::|| ||||||||:|
GCAGGGTGTCATGTGTTATGTg
mmu-miR-466f-3p 17.3949 -22.37 2.777790e-02 1.000000e-06 1.362680e-10 243 263
cACACAUACACACACACAUac
 || || ||||||||||||
cTGAGTCTGTGTGTGTGTAgg
hsa-miR-524-5p 17.3095 -17.03 3.352340e-02 3.296770e-02 3.296770e-02 435 457
cuCUUUCACG-AAGGGAAACAUc
  ||||   | |||||||||||
ttGAAATACCATTCCCTTTGTAt
hsa-miR-642 17.0984 -23.09 4.284180e-02 4.193710e-02 2.054500e-03 217 237
guucUGUGUAAACCUCUCCCUg
    ||||:| | ||||||||
atgtACACGTGT-GAGAGGGAg
hsa-miR-520d-3p 17.0984 -23.13 3.468980e-02 1.155520e-04 1.155520e-04 379 400
uggguGGUUUCUCUUCGUGAAA
     ||| || ||||||:|||
aaagcCCACAGTGAAGCATTTT
hsa-miR-582-5p 17.0186 -21.83 3.246520e-02 3.194390e-02 2.104220e-05 99 123
ucAUUGA--CCAACUUGUUGACAUU
  |||||   |||||: ||||||:|
ttTAACTACTGTTGAGGAACTGTGA
hsa-miR-605 17.0186 -16.34 2.442850e-02 2.413250e-02 5.422670e-04 78 100
uccUCUUCCGUGGUACCCUAAAu
   || || :: | ||||||||
tacAGCAGCTGACCTGGGATTTt
bta-miR-218 16.9707 -20.64 2.613660e-02 2.579800e-02 1.359070e-03 322 341
UGUACCAAUCUA-GUUCGUGUu
::||||  |||| ||||||||
GTATGG--AGATACAAGCACAc
hsa-miR-373 16.9135 -21.42 4.413880e-02 4.317890e-02 3.293520e-02 379 400
UGUGGGGUUUUAGCUUCGUGAAG
| | |||| |:| ||||||:||:
AAAGCCCACAGT-GAAGCATTTT
mmu-miR-693-3p 16.9135 -22.44 5.250070e-02 5.114630e-02 3.105430e-02 504 527
aAUGU-CGGUGUAGACUUUCGACG
 ||:|  :|| |||| |:||||||
aTATACTTCAGATCTCAGAGCTGC
hsa-miR-583 16.8646 -18.4 5.259110e-02 5.123210e-02 1.946900e-02 570 590
CAUUACCCUGGAAGGAGAAAc
| | | ||: :| |||||||
GAATTTGGGATTGCCTCTTTt
hsa-miR-636 16.7034 -22.46 2.642820e-02 2.608200e-02 2.461380e-03 317 340
ACGCCCGCCCUGCU-CGUUCGUGU
||:| |:  |: ||  ||||||||
TGTGTGTATGGAGATACAAGCACA
hsa-miR-655 16.6763 -18.86 4.942320e-02 4.822170e-02 1.488790e-02 165 185
UUUCUCCAAUUGGUACAUAAUA
:|: ||| | ::|||||:||||
GAGCAGGGT-GTCATGTGTTAT
mmu-miR-291a-3p 16.5707 -19.21 4.486030e-02 4.386900e-02 9.087250e-04 380 400
cgUGUGUUUCACCUUCGUGAAA
  :| || ||| ||||||:|||
aaGCCCACAGT-GAAGCATTTT
hsa-miR-381 16.5707 -26.21 4.255990e-02 4.166690e-02 4.166690e-02 295 316
UGUCUCUCGAACGGGAACAUAU
| ||||:|||||:|:|| ||||
AAAGAGGGCTTGTCTTTATATA
hsa-miR-146b-5p 16.5707 -14.12 4.715690e-02 4.715690e-02 2.724240e-02 546 568
UCGGAUACCUU-AAGUCAAGAGu
:|::| |  ||  |||||||||
GGTTTTTAAAACATCAGTTCTCc
mmu-miR-466f-5p 16.5707 -18.94 3.683490e-02 1.000000e-06 1.362680e-10 206 227
guacGUGUACGUGUGUGUGCAU
    :|: ||:|:::||||||:
ctgtTATCTGTATGTACACGTG
bta-miR-181b 16.5584 -18.97 5.861860e-02 5.861860e-02 6.975230e-05 103 128
uuugGGUGGCU-GUCGUUACUUACAA
    |::::||  | | :||||||||
actaCTGTTGAGGAACTGTGAATGTT
bta-miR-27b 16.5464 -15.91 5.877570e-02 5.708180e-02 2.504590e-05 104 124
cGUCUUGAAUCGGUGACACUU
 :|  ::| ||  ||||||||
cTACTGTTGAGGAACTGTGAA
bta-miR-27a 16.5259 -15.91 5.550350e-02 5.550350e-02 2.504590e-05 105 124
gccuUGAAUCGGUGACACUU
    ::| ||  ||||||||
tactGTTGAGGAACTGTGAA
hsa-miR-548c-3p 16.4652 -13.05 7.936860e-02 3.629530e-03 7.352860e-05 79 102
cGUUUUC-AUU-AACUCUAAAAAc
 ||: || |:|  ||:|||||||
aCAGCAGCTGACCTGGGATTTTTa
mmu-miR-703 16.4403 -10.18 4.207850e-02 4.120550e-02 4.120550e-02 531 551
aagAAAGGAAGACUUCCAAAA
   | |  | || ||||||||
tcaTATGGTACTAAAGGTTTT
mmu-miR-466c-5p 16.3596 -17.84 7.571580e-02 1.000000e-06 1.362680e-10 323 344
AUACAUGUACGUGUGUGUGUag
|||| | || || :||||||
TATGGAGATACAAGCACACAcc
hsa-miR-134 16.3596 -21.11 5.666230e-02 5.508690e-02 8.111910e-03 514 535
ggGGAGACCAGUUGGUCAGUGU
  :||| |  | :|||||||:|
gaTCTCAGAGCTGCCAGTCATA
mmu-miR-878-3p 16.3596 -24.04 2.852710e-02 2.812400e-02 2.158890e-06 156 180
aGAUGGG---UCACACCACAGUACG
 :||||:   ||   |||||||||:
aTTACCTTGGAGCAGGGTGTCATGT
mmu-miR-294 16.3596 -17.27 5.712780e-02 5.552660e-02 1.738470e-02 379 400
UGUGUGUUUUCCCUUCGUGAAA
| |  | | || ||||||:|||
AAAGCCCACAGTGAAGCATTTT
mmu-miR-683 16.3343 -15.21 6.303640e-02 6.109070e-02 1.987470e-02 66 86
cUCCUGUGUCGAAUGUCGUCc
 || |: :  | ||||||||
cAGTATTTCACATACAGCAGc
hsa-miR-379 16.3343 -17.61 3.433200e-02 3.374930e-02 3.848050e-06 27 47
GGAUGCAAGGUAUCAGAUGGu
||   |||  : ||||||||
CCCCGGTTGGGAAGTCTACCt
hsa-miR-516a-3p 16.2823 -21.97 9.714650e-02 9.257690e-02 1.513600e-02 222 239
ugGGAGACUUUCCUUCGU
  | | |||:|||:|||:
caCGTGTGAGAGGGAGCG
bta-miR-106 16.2541 -17.81 6.700780e-02 6.481210e-02 2.159230e-02 381 401
aUGGACGUGACAUUCGUGAAAA
 :||  || || |||||:||||
aGCCCACAGTG-AAGCATTTTT
mmu-miR-466g 16.2282 -14.44 4.542930e-02 1.000000e-06 1.362680e-10 234 254
aCACACACGUACACAGACAUA
 | | | || || ||||||:|
gGAGCGAGCCTGAGTCTGTGT
hsa-miR-518a-5p 16.206 -15.74 6.853690e-02 6.624100e-02 5.908050e-04 437 457
CUUUCCCG-AAGGGAAACGUc
||||   | |||||||||:|
GAAATACCATTCCCTTTGTAt
bta-miR-15b 16.1485 -16.21 8.596810e-02 8.237650e-02 6.785890e-03 190 211
acaUUUGGUACUACACGACGAU
   |:|  ||||  |||||:||
ctcAGAGAATGAGATGCTGTTA
bta-let-7i 16.1485 -18.48 9.288530e-02 8.870200e-02 1.679190e-13 28 49
uuGUCGUGUUUGAUGAUGGAGU
  |:|:  ::|   ||||||||
ccCGGTTGGGAAGTCTACCTCA
hsa-miR-297 16.1221 -13.99 8.934840e-02 8.547310e-02 1.238090e-03 272 292
guacgugUACGUGUGUAUGUA
       |||:| |||||:||
ctttataATGTAGACATATAT
mmu-miR-466d-3p 16.1221 -21.35 6.982640e-02 1.000000e-06 1.362680e-10 241 261
gauACACACGCACAUACAUAU
   || || :||||:|||:||
gccTGAGTCTGTGTGTGTGTA
mmu-miR-466a-5p 16.043 -16.28 9.521760e-02 1.000000e-06 1.362680e-10 271 293
AUACAUG-UACAUGUGUGUGUAU
| | ||: ||||| |||:|:|||
TCTTTATAATGTAGACATATATA
hsa-miR-659 16.043 -16.91 7.735690e-02 7.444050e-02 5.346870e-03 480 501
accccuGGGAGGGACUUGGUUc
      :::| : ||||||||
gttaccTTTTATGTGAACCAAa
hsa-miR-520b 16.0161 -17.16 8.127530e-02 1.155520e-04 1.155520e-04 380 400
gggaGAUUUUCCUUCGUGAAA
    | | |: ||||||:|||
aagcCCACAGTGAAGCATTTT
hsa-miR-520e 16.0161 -19.69 8.541830e-02 1.155520e-04 1.155520e-04 380 400
gggaGUUUUUCCUUCGUGAAA
    | | |: ||||||:|||
aagcCCACAGTGAAGCATTTT
mmu-miR-466a-3p 15.9681 -19.49 7.906330e-02 1.000000e-06 1.362680e-10 239 261
agaauACACACGCACAUACAUAU
     || || :||||:|||:||
gagccTGAGTCTGTGTGTGTGTA
hsa-miR-194 15.9374 -14.65 5.510000e-02 5.360950e-02 1.070450e-02 192 213
aggUGUACCUCAACGACAAUGu
   | |  ||| ||||||||:
cagAGAATGAGATGCTGTTATc
hsa-miR-520c-3p 15.9374 -17.19 8.956920e-02 1.155520e-04 1.155520e-04 379 400
ugggaGAUUUUCCUUCGUGAAA
     | | |: ||||||:|||
aaagcCCACAGTGAAGCATTTT
hsa-miR-216a 15.9374 -19.34 5.858050e-02 5.689770e-02 6.574130e-03 77 99
aGUGUCAACGG-UCGACUCUAAu
 :||||  ||: | |||:||||
aTACAGCAGCTGACCTGGGATTt
hsa-miR-146a 15.9374 -13.19 8.642820e-02 8.279860e-02 2.724240e-02 546 568
UUGGGUACCUU-AAGUCAAGAGu
::::: |  ||  |||||||||
GGTTTTTAAAACATCAGTTCTCc
bta-miR-199a-3p 15.9374 -10.74 7.032850e-02 6.791240e-02 9.342050e-05 90 110
auuggUUACACGUCUGAUGACA
     :|| | :| ||||||||
cctggGATTTTTA-ACTACTGT
mmu-miR-697 15.91 -22.81 6.677200e-02 6.459150e-02 6.739210e-05 156 176
aGAGGUGUCCUGGUCCUACAa
 :| | : ||| ||||:|||
aTTACCTTGGAGCAGGGTGTc
bta-miR-181a 15.897 -15.84 7.614970e-02 7.332250e-02 6.975230e-05 102 128
UUGA--GUGGCU-GUCGCAACUUACAA
||||  ::::||  | |  ||||||||
AACTACTGTTGAGGAACTGTGAATGTT
hsa-miR-520d-5p 15.8862 -19.28 9.052800e-02 1.155520e-04 1.155520e-04 296 315
cUUUCCCGAAGGGAAACAUc
 |:||||||| :|||| ||
aAGAGGGCTTGTCTTTATAt
mmu-miR-466a-3p 15.863 -16.59 8.455090e-02 1.000000e-06 1.362680e-10 304 326
AGAAUACACACGCACAUACAUAU
|: | | | | : |||:|||||:
TTGTCTTTATATATGTGTGTATG
hsa-miR-421 15.863 -9.63 6.670990e-02 6.453350e-02 1.115970e-04 92 114
cgcggguuAAUUACAGACAACUa
        ||||   |||||||
tgggatttTTAACTACTGTTGAg
hsa-miR-548d-3p 15.8319 -9.54 8.771870e-02 3.629530e-03 7.352860e-05 531 553
cGUUUUCUUUGA-CACCAAAAAc
 || | |: |||   |||||||
tCATATGGTACTAAAGGTTTTTa
hsa-miR-626 15.7591 -17.06 8.469920e-02 8.121140e-02 2.962170e-02 391 409
UUCUGUAAAAGUCUGUCGA
:| :||||||:|||::|:|
GAAGCATTTTTAGATGGTT
bta-miR-380-3p 15.6979 -7.83 8.595470e-02 8.236420e-02 4.519260e-03 443 463
ucugcaccuGGUGUAAUGUAu
         ::::|||||||
ccattccctTTGTATTACATt
mmu-miR-466b-3-3p 15.6529 -16.59 9.761660e-02 1.000000e-06 1.362680e-10 304 326
AGAAUACACACGCACAUACAUAa
|: | | | | : |||:|||||
TTGTCTTTATATATGTGTGTATg
hsa-miR-643 15.6208 -14 7.806200e-02 7.509290e-02 8.570650e-03 314 337
gAUGGACUCG-AUC-GUAUGUUCa
 ||: || |: |:|  |||||||
aTATGTGTGTATGGAGATACAAGc
bta-miR-20b 15.6208 -16.47 9.743670e-02 9.284020e-02 3.573350e-02 379 401
auggacGUGACAC-UCGUGAAAc
      ||| ||| ||||:|||
aaagccCACAGTGAAGCATTTTt
mmu-miR-466d-3p 15.5918 -14.7 9.838010e-02 1.000000e-06 1.362680e-10 306 326
gAUACACACGCACAUACAUAU
 | | | | : |||:|||||:
gTCTTTATATATGTGTGTATG
mmu-miR-667 15.5478 -28.13 5.692340e-02 5.533360e-02 2.852030e-02 161 184
GAACC-CGACCCACCGUCCACAGU
||||| || ||||| || ||||:|
CTTGGAGCAGGGTGTCATGTGTTA
hsa-miR-212 15.3797 -10.38 7.797050e-02 7.500830e-02 1.322220e-03 463 483
ccggcacugaccuCUGACAAU
             ||||||||
tagagnnnnnnnnGACTGTTA
bta-miR-132 15.3042 -9.41 8.770370e-02 8.396770e-02 7.050580e-03 462 483
gcugguaccgacauCUGACAAU
              ||||||||
ttagagnnnnnnnnGACTGTTA
bta-miR-10b 15.2327 -19.32 8.062050e-02 7.745630e-02 3.045750e-07 151 174
gUGUUUAA-GCCAAGAUGUCCCAU
 :|||||| |  |   :||||||:
aGCAAATTACCTTGGAGCAGGGTG
bta-miR-342 15.1004 -15.34 9.552250e-02 9.110210e-02 2.862710e-04 208 232
ucuacccacgcuaaagaCACACUCU
                 ||||||||
gttatctgtatgtacacGTGTGAGA
hsa-miR-95 15.0931 -10.61 8.500220e-02 8.148970e-02 2.104570e-03 94 114
aCGAGUUAUUUAUGGGCAACUU
 | |:  ||| || |:|||||:
gGATTTTTAACTA-CTGTTGAG
mmu-miR-715 14.9554 -21.56 7.198110e-02 6.945150e-02 6.036710e-04 309 329
gugcgccccCACACGUGCCUC
         |||||:|:||||
tttatatatGTGTGTATGGAG
Features
EntrezGene 540646
RefSeq_dna_predicted XM_612469
RefSeq_peptide_predicted XP_612469
spacer
spacer