spacer

Target Detailed View


Hit information for ENSBTAT00000023262

Gene Name LOC507323
Transcript ENSBTAT00000023262
Gene ENSBTAG00000017502
Description
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
mmu-miR-881 18.8873 -20.72 5.742320e-03 5.725860e-03 3.262090e-03 466 487
agAUAAGUCUUUUCUGUGUCAa
  |: |||||:|| |||||||
gaTGCTCAGAGAATACACAGTc
hsa-miR-892a 18.1279 -19.7 9.769230e-03 9.721670e-03 9.721670e-03 467 487
gAUGCGUCUUUCCUGUGUCAc
 |:| ||||:|  |||||||
aTGCTCAGAGAATACACAGTc
hsa-miR-196a 17.8262 -20.53 1.448750e-02 1.448750e-02 1.448750e-02 315 336
GGGUUGUUGUACUUUGAUGGAu
|||| :||  ||:||||||:|
CCCATTAAGTTGGAACTACTTc
bta-miR-204 17.8262 -21.52 2.877160e-02 2.836160e-02 1.568440e-03 558 579
UCCGUAUCCUACUGUUUCCCUU
:| :||:| :|  ||||||||:
GGATATGGTGTTTCAAAGGGAG
mmu-miR-742 17.5079 -21.74 2.140150e-02 2.125170e-03 1.380060e-04 152 173
aAAUGGGUCGUACCACCGAAAG
 | :||:||| | ||||:|||:
aTGGCCTAGCTTTGTGGTTTTT
hsa-miR-939 17.4529 -27.74 6.930030e-02 6.695360e-02 2.575840e-02 498 521
gugggggucUCGGAGUCGAGGGGU
         :|:||| ||||||||
taaagaatcGGTCTCTGCTCCCCA
mmu-miR-682 17.2748 -24.02 2.545660e-02 2.513530e-02 6.840770e-03 385 405
gucugaagUGACACUGACGUC
        | |||||||||||
agaggtggAATGTGACTGCAG
hsa-miR-512-3p 17.1896 -22.21 2.631260e-02 2.596940e-02 1.707420e-03 2 23
cuGGAGUCGAUACUGUCGUGAa
  |||   :| ||:|||||||
ttCCTGCTTTTTGGCAGCACTg
hsa-miR-196b 16.9773 -17.82 3.024110e-02 2.978840e-02 2.978840e-02 315 336
GGGUUGUUGUCCUUUGAUGGAu
|||| :||   |:||||||:|
CCCATTAAGTTGGAACTACTTc
bta-miR-181b 16.9595 -23.01 4.152880e-02 4.152880e-02 2.201580e-03 235 260
UUUGGGUGGCUGUCGU-UACUUACAA
| ::|::|||  ||||  ||:|||||
ATGTCTGCCGCGAGCACTTGGATGTT
hsa-miR-520d-5p 16.722 -14.4 4.678150e-02 4.069730e-03 3.090630e-05 149 168
cUUUCCCGAAGGGAAACAUC
 ||| ||| |  ||||||:|
cAAATGGCCTAGCTTTGTGG
hsa-miR-211 16.659 -21.87 7.261290e-02 7.003920e-02 6.514560e-03 557 579
UCCGCUUCC-UACUGUUUCCCUU
|||  | || :|  ||||||||:
AGGATATGGTGTTTCAAAGGGAG
hsa-miR-548d-3p 16.659 -15.02 4.915640e-02 4.796780e-02 2.124960e-03 153 174
cguuuucuuuGACACCAAAAAc
          :||||||||||
tggcctagctTTGTGGTTTTTa
mmu-miR-679 16.4468 -20.72 5.021080e-02 4.897110e-02 4.897110e-02 469 488
UGGUUCUCAGUGGAGUGUCAGG
:|: ||||  | : ||||||||
GCTCAGAG--AATACACAGTCC
bta-miR-19b 16.3696 -14.75 4.873130e-02 4.873130e-02 4.601870e-06 73 95
agucaAAACGUACCUAAACGUGU
     | ||  |  |||||||||
actagTGTGATTTCATTTGCACA
bta-miR-19a 16.3696 -14.75 5.585420e-02 5.432300e-02 4.601870e-06 73 95
agucaAAACGUAUCUAAACGUGU
     | ||  |  |||||||||
actagTGTGATTTCATTTGCACA
mmu-miR-742 16.1285 -12.52 6.665520e-02 2.125170e-03 1.380060e-04 283 304
AAAUGGGUCGUACCACCGAAAG
| |:: | |::   |||||||:
TCTGTGCTGTGCTTTGGCTTTT
hsa-miR-888 16.1019 -13.16 5.526270e-02 5.376350e-02 5.249070e-03 42 60
acuGACUGUCGAAAAACUCAU
   || ::||  ||||||||:
tccCTAGTAG--TTTTGAGTG
hsa-miR-554 16.1019 -14.28 4.583260e-02 4.479820e-02 6.274260e-03 58 78
ugaccgacUCAGUCCUGAUCG
        | || |||||||:
gtgaataaAATCTGGACTAGT
bta-miR-17-3p 16.0789 -18.12 8.186730e-02 7.860580e-02 3.744760e-03 385 406
UGUUCAC--GGAAGUGACGUCA
| |:|||   : | ||||||||
AGAGGTGGAATGTGACTGCAGT
bta-miR-181a 15.9809 -19.69 7.088710e-02 6.843290e-02 2.201580e-03 236 260
uUGAGUGGCUGUCG-CAACUUACAA
 :: ::|||  |||  |||:|||||
tGTCTGCCGCGAGCACTTGGATGTT
hsa-miR-579 15.9472 -8.94 8.885670e-02 8.502330e-02 5.018120e-03 135 156
UUAGCGCCAAAUAUGGUUUACUu
|||  :| |||| | ||||||:
AATGATGATTTA-AGCAAATGGc
mmu-miR-883b-3p 15.9163 -15.76 5.294820e-02 5.294820e-02 2.682010e-02 386 408
uaugACUCUCUAC-AACGUCAAU
    ||: | :||  |||||||:
gaggTGGAATGTGACTGCAGTTG
bta-miR-23a 15.9163 -17.98 7.961970e-02 7.961970e-02 1.097310e-03 62 83
accUUUAGGGACCGUUACACUA
   |||||:    :|:||||||
ataAAATCTGGACTAGTGTGAT
hsa-miR-509-5p 15.8886 -15.16 8.721580e-02 8.721580e-02 4.018330e-02 387 407
aCUAACGGUGACAGACGUCAu
 |:| |    || |||||||
aGGTGGAATGTGACTGCAGTt
hsa-miR-606 15.8886 -10.6 5.275230e-02 5.138500e-02 4.839400e-03 33 54
uagaaACUAAAAG-UCAUCAAA
     || ||  | ||||||||
cctacTGCTTCCCTAGTAGTTT
hsa-miR-372 15.8415 -16.77 8.404840e-02 8.061320e-02 2.472250e-03 231 254
ugcgaguuuACAGCG-UCGUGAAa
         || ||| |||||||
accgatgtcTGCCGCGAGCACTTg
bta-miR-210 15.8415 -18.64 5.428370e-02 5.283660e-02 1.026460e-04 74 97
aGUCG-GCGACAGUGUGCGUGUCa
 :||: :| | |||: :||||||
cTAGTGTGATTTCATTTGCACAGa
bta-miR-23b 15.7359 -18.77 8.655730e-02 8.291700e-02 1.097310e-03 59 83
caccAUUAGGGACC--GUUACACUA
    |||  :||||  :|:||||||
tgaaTAAAATCTGGACTAGTGTGAT
hsa-miR-509-3-5p 15.704 -16.47 9.761240e-02 9.299960e-02 4.018330e-02 386 407
guacuaacgGUGCAGACGUCAu
         :::| |||||||
gaggtggaaTGTGACTGCAGTt
bta-miR-25 15.704 -13.04 6.210370e-02 2.706120e-03 2.706120e-03 63 84
AGUCUGGCUCUGUUCACGUUAc
| | |:| :||| ||||::||
TAAAATCTGGACTAGTGTGATt
hsa-miR-520a-3p 15.704 -11.59 9.304980e-02 4.069730e-03 3.090630e-05 234 254
uguCAGGUUUCCCUUCGUGAAa
   |||::  | | |||||||
gatGTCTGCCGCG-AGCACTTg
bta-miR-101 15.6753 -18.69 7.592290e-02 7.311230e-02 2.960880e-02 478 498
aagucaaUAGUGUCAUGACAu
       :|| ||||:||||
atacacaGTCCCAGTGCTGTt
mmu-miR-883a-3p 15.5979 -13.77 7.147650e-02 6.898180e-02 2.682010e-02 387 408
UAUGACUCUCGACAACGUCAAU
| :: ||  |:   |||||||:
AGGTGGAATGTGACTGCAGTTG
bta-miR-25 15.4918 -20.66 7.543530e-02 2.706120e-03 2.706120e-03 364 385
aGUCUGGCUCUGUUCACGUUac
 | ||| |||:|| |||||:
cCCGACAGAGGCACGTGCAGaa
mmu-miR-690 15.3857 -16.36 8.984570e-02 8.592780e-02 5.133490e-03 144 165
aaaccaacacUCGGAUCGGAAa
          :|||||||:||
ttaagcaaatGGCCTAGCTTTg
mmu-miR-687 15.3857 -14.75 8.923610e-02 8.537040e-02 3.578810e-02 542 563
aguaacGACGUAAGGUCCUAUc
      |||    :|||||||
atttctCTGACACTCAGGATAt
Features
EntrezGene 507323
RefSeq_dna_predicted XM_583916
RefSeq_peptide_predicted XP_583916
spacer
spacer