spacer

Target Detailed View


Hit information for ENSBTAT00000022573

Gene Name LOC508331
Transcript ENSBTAT00000022573
Gene ENSBTAG00000016972
Description
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
hsa-miR-637 17.9635 -37.55 3.995400e-02 3.916640e-02 4.302080e-03 16 42
uGCGUCUCG--GGCUUUC-GGGGGUCa
 :|||||||  ||| |:| |||||||
cTGCAGAGCAGCCGCAGGACCCCCAGa
hsa-miR-500 17.9388 -22.94 1.024130e-02 1.018900e-02 4.770110e-06 359 381
AGAGUGGGUCCAUCGUUCCUAAU
|||  |:| || : ||||||||:
TCTACCTCTGGGGACAAGGATTG
hsa-miR-323-3p 17.582 -22.12 8.414230e-03 8.239860e-04 8.239860e-04 121 141
ucuccaGCUGGCACAUUACAC
      | :|:||||||||||
tggccaCCGCTGTGTAATGTG
mmu-miR-466f-3p 17.582 -26.34 2.452580e-02 7.124720e-04 7.045960e-07 130 155
cACACA-UACACA----CACACAUAC
 ||||| ||||||    |||||||||
cTGTGTAATGTGTACTGGTGTGTATG
hsa-miR-330-3p 17.4142 -20.4 2.267550e-02 2.242030e-02 9.049130e-03 217 239
agAGACGUCCGGCACACGAAACG
  || || | || ||||:|||||
cgTCAGCTGTCCTTGTGTTTTGC
mmu-miR-466a-3p 17.3093 -19.25 3.311440e-02 7.124720e-04 7.045960e-07 133 155
AGAAUACACACGCACAUACAUAU
| | |||||| |  ||:|||||:
TGTAATGTGTACTGGTGTGTATG
bta-let-7g 17.285 -20.8 2.754200e-02 2.754200e-02 4.378540e-06 343 367
uUGACAUGUUUGAU---GAUGGAGu
 |||| ||||| |:   |||||||
tACTGGACAAAATGATTCTACCTCt
mmu-miR-466h 17.285 -23.78 3.377640e-02 7.124720e-04 7.045960e-07 154 174
AUGUGUGUUCGUGUACGUGUGU
|::: : |:|| |:||||||||
TGTGGGGAGGC-CGTGCACACA
bta-miR-98 17.1796 -14.88 3.174920e-02 3.125050e-02 2.044950e-06 348 367
UUGUUAUGUUGAAUGAUGGAGu
:|||| |::|:|  |||||||
GACAAAATGATT--CTACCTCt
hsa-miR-652 17.1584 -27.4 8.218350e-03 8.184670e-03 8.184670e-03 191 211
gUGUUGGGAUCACCGCGGUAa
 :||:|    ||||||||||
gGCAGCAGCCGTGGCGCCATc
mmu-miR-466b-3-3p 17.0995 -18.92 3.823180e-02 7.124720e-04 7.045960e-07 133 155
AGAAUACACACGCACAUACAUAa
| | |||||| |  ||:|||||
TGTAATGTGTACTGGTGTGTATg
mmu-miR-466d-3p 17.0525 -19.25 3.787930e-02 7.124720e-04 7.045960e-07 135 155
gaUACACACGCACAUACAUAU
  |||||| |  ||:|||||:
taATGTGTACTGGTGTGTATG
hsa-miR-362-5p 17.0235 -25.91 2.691130e-02 2.403080e-03 4.901760e-08 357 380
UGAG-UGUGGAUCCAAGGUUCCUAA
|:|| || :||:||   ||||||||
ATTCTACCTCTGGG-GACAAGGATT
mmu-miR-702 16.9465 -25.78 4.912620e-02 4.793900e-02 4.793900e-02 259 278
CUCGCCCCAUUUCCCACCCGU
||| |  ||::| |||||||:
GAGGGTCGTGGA-GGTGGGCG
hsa-miR-615-5p 16.8635 -33.56 7.299890e-02 7.039810e-02 2.072280e-03 16 39
cuaGGCUCGU-GGC-CCCUGGGGG
   | ||||| |||  ||||||||
ctgCAGAGCAGCCGCAGGACCCCC
hsa-miR-323-5p 16.7581 -21.18 4.115500e-02 8.239860e-04 8.239860e-04 108 129
CGCUUGCGCGGUGCCUGGUGGa
|: ||:|:|:: | |:|||||
GTAAATGTGTTTCTGGCCACCg
mmu-miR-683 16.7347 -20.32 4.428390e-02 4.331770e-02 4.331770e-02 160 179
CUCCUGUGUCGAAUGUCGUCc
|||| |:: ||  |||||||
GAGGCCGT-GCACACAGCAGa
hsa-miR-770-5p 16.575 -22.19 3.169870e-02 3.120160e-02 7.659150e-04 127 148
acCGGGACUGUGCACCAUGACCu
  ||: ||  |:|| |||||||
ccGCTGTGTAATGT-GTACTGGt
hsa-miR-498 16.4701 -21.46 4.288830e-02 4.198160e-02 4.198160e-02 450 474
CUUUUUGCGGGGGAC--CGAACUUu
|| :| | |::|| |  |||||||
GACGACCCCTTCCAGGAGCTTGAAt
bta-let-7i 16.4419 -18.5 6.967650e-02 6.967650e-02 4.378540e-06 343 367
uUGUCGUGUUUGAU---GAUGGAGu
 || | ||||| |:   |||||||
tACTGGACAAAATGATTCTACCTCt
hsa-miR-602 16.3652 -33.72 4.222980e-02 4.135050e-02 4.135050e-02 213 235
CCCGGC-GUCGACAGCGGGCACAG
| |||| |||||||| |::||||:
GCGCCGTCAGCTGTC-CTTGTGTT
bta-let-7f 16.3365 -12.92 7.050930e-02 7.050930e-02 4.378540e-06 348 367
UUGAUAUGUUAGAUGAUGGAGu
:|| | |::||:  |||||||
GACAAAATGATT--CTACCTCt
mmu-miR-689 16.3111 -31.05 6.294560e-02 3.611730e-03 3.611730e-03 425 445
ccuGGGGCGGCUCGCCCCUGc
   ||||   ||||||||:|
ttcCCCCTGGGAGCGGGGGCa
hsa-miR-520a-5p 16.3111 -18.9 8.791590e-02 8.416210e-02 2.171080e-04 349 371
UCUUUCAUGAAG--GGAGACCUC
| ||| |: |||  |||||||:|
ACAAAATGATTCTACCTCTGGGG
hsa-miR-519b-3p 16.2311 -12.58 6.406930e-02 6.206000e-02 4.025910e-05 318 339
UUGGAGAUUUUCCUACGUGAAa
|:|: | ::|||  ||||:||
AGCTACGGGAAGCTTGCATTTc
bta-let-7e 16.2051 -20.47 9.515750e-02 9.077030e-02 4.378540e-06 344 367
UGAUAUGUU---GGAGGAUGGAGu
|||: ||||     |:|||||||
ACTGGACAAAATGATTCTACCTCt
bta-let-7a 16.1257 -18.33 9.379060e-02 9.077030e-02 4.378540e-06 343 367
uUGAUAUGUUGGAU---GAUGGAGu
 |||: ||||  |:   |||||||
tACTGGACAAAATGATTCTACCTCt
hsa-miR-638 15.8073 -34.27 7.937890e-02 7.631010e-02 1.217670e-02 220 246
ucCGGCGGUGG-GC-GGGCGCUAGGGA
  ||:|:| :: :| :::|||:|||||
caGCTGTCCTTGTGTTTTGCGGTCCCT
mmu-miR-689 15.7815 -30.37 8.749690e-02 3.611730e-03 3.611730e-03 264 284
ccuggggCGGCUCGCCCCUGC
       | :|:||||||:||
tcgtggaGGTGGGCGGGGGCG
mmu-miR-704 15.7815 -24.22 6.542260e-02 6.332850e-02 4.356620e-03 541 560
gaUCCUCGUCUCGUGUACAGa
  :|||| :|:| ||:||||
ggGGGAG-GGGGGACGTGTCg
hsa-miR-362-3p 15.4933 -12.22 7.098130e-02 2.403080e-03 4.901760e-08 131 153
ACUUAGGA-ACUUAUCCACACAa
|| :|  | || |  |||||||
TGTGTAATGTGTACTGGTGTGTa
bta-miR-425-5p 15.3879 -24.84 4.444170e-02 4.346860e-02 4.346860e-02 540 561
AGUUGCCCUCACUAGCACAGUa
| :: | |:| |: ||||||:
TGGGGGAGGGGGGACGTGTCGg
hsa-miR-329 15.3879 -13.45 7.838610e-02 7.539260e-02 1.045460e-03 133 153
uuucUCCAAUUGGUCCACACAa
    | ||  ||: |||||||
tgtaATGTGTACT-GGTGTGTa
hsa-miR-518c 15.0014 -21.69 9.392890e-02 8.965250e-02 9.769540e-04 386 410
UGUGAGAU--UUCUCUUCGCGAAAC
:||:||||  : || |:|| |||||
GCATTCTAGTGCGACAGGCTCTTTG
bta-miR-99a 14.8282 -20.38 5.591840e-02 5.438370e-02 2.304830e-03 307 328
UGUUCUAGC-CUAGAUGCCCaa
::|| : || || |||||||
GTAATGACGAGAGCTACGGGaa
bta-miR-363 14.8282 -23.41 8.900150e-02 8.515580e-02 1.469390e-02 150 172
GCGUCUA--CCUAUGGCACGUua
:|:| :|  ||| :|||||||
TGTATGTGGGGAGGCCGTGCAca
bta-miR-99b 14.7555 -19.88 5.045990e-02 5.045990e-02 2.304830e-03 306 328
GCGUUCCAGC-CAAGAUGCCCac
:|:|| | || |  |||||||
TGTAATGACGAGAGCTACGGGaa
hsa-miR-100 14.4393 -18.87 7.630770e-02 7.346890e-02 6.043970e-04 306 328
GUGUUCAAGC-CUAGAUGCCCaa
:::||   || || |||||||
TGTAATGACGAGAGCTACGGGaa
Features
EntrezGene 508331
RefSeq_peptide_predicted XP_585093
UniGene Bt.82854
spacer
spacer