spacer

Target Detailed View


Hit information for ENSBTAT00000020250

Gene Name LOC528046
Transcript ENSBTAT00000020250
Gene ENSBTAG00000015220
Description
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
bta-miR-148b 18.5671 -19.28 5.553670e-03 2.868600e-03 8.258450e-06 208 229
UGUUUCAAGACACUACGUGACU
|: |  ||:| ||||||||||:
ATTATCTTTTCTGATGCACTGG
hsa-miR-495 18.0335 -15.54 1.687980e-02 1.673810e-02 1.673810e-02 13 33
UUCUUCACGUGGUACAAACAAa
||||| |  |||| |||||||
AAGAACTCAACCA-GTTTGTTa
hsa-miR-362-3p 18.0335 -21.37 9.718270e-03 9.671200e-03 6.687630e-04 378 401
ACUUAGG-AACUUA-UCCACACAa
|| ||:| ||||:| :|||||||
TGTATTCATTGAGTGGGGTGTGTg
hsa-miR-152 17.8018 -18.88 1.334220e-02 4.649760e-03 5.520280e-06 209 229
GGUUCAAGACAGUACGUGACU
::|  ||:| | ||||||||:
TTATCTTTTCTGATGCACTGG
bta-let-7g 17.5 -21.47 2.216780e-02 4.338330e-03 1.228380e-06 224 246
uUGACAUG-UUUGAUGAUGGAGU
 |||| || :||:| :|||||||
cACTGGACTGAATTTTTACCTCA
bta-miR-148a 17.3933 -17.02 1.619750e-02 2.868600e-03 8.258450e-06 208 229
UGUUUCAAGACAUCACGUGACU
|: |  ||:| |: |||||||:
ATTATCTTTTCTGATGCACTGG
hsa-miR-622 17.3728 -19.73 2.807850e-02 2.768800e-02 2.768800e-02 576 596
cgaGGUUGGAGUCGUCUGACa
   :::|:|||  |||||||
ctgTTGATCTCTACAGACTGg
hsa-miR-942 17.1799 -17.64 7.406840e-02 7.139180e-02 8.478760e-03 339 360
GUGUACCGGUUUUGUCUCUUCU
| : | |:|  | |||||||||
CCTCTAGTCTTACCAGAGAAGA
hsa-miR-491-3p 17.0732 -15.39 1.834040e-02 1.817320e-02 4.446010e-03 385 407
cAUCUUCCCUUAGA-ACGUAUUc
 | ||: ||::| | |||||||
aTTGAGTGGGGTGTGTGCATAAa
bta-miR-499 17.0511 -13.69 3.596060e-02 3.532170e-02 2.108330e-03 332 351
uuUGUAGUGACGUUCAGAAUu
  :|||| || | |||||||
ccGCATCCCT-CTAGTCTTAc
hsa-miR-301b 16.9926 -16.8 3.190910e-02 3.190910e-02 2.511900e-03 111 133
cgaaacuGUUAUAGUAACGUGAC
       |:: || :||||||||
agcaactCGGAATAGTTGCACTG
bta-let-7e 16.9438 -19.48 4.734610e-02 4.338330e-03 1.228380e-06 225 246
UGAUAUG-UUGGAGGAUGGAGU
|||: || :| :|::|||||||
ACTGGACTGAATTTTTACCTCA
mmu-miR-721 16.8366 -19.59 3.200800e-02 3.150120e-02 4.279600e-03 113 133
aagggggaaaAUUAACGUGAC
          ||:||||||||
caactcggaaTAGTTGCACTG
hsa-miR-301a 16.6739 -16.27 4.323060e-02 4.230950e-02 2.511900e-03 111 133
cgaaacuGUUAUGAUAACGUGAC
       |:: |: :||||||||
agcaactCGGAATAGTTGCACTG
bta-let-7i 16.6463 -18.67 5.691380e-02 4.338330e-03 1.228380e-06 225 246
UUGUCGUGUUUGAUGAUGGAGU
| ::|  ::||:| :|||||||
ACTGGACTGAATTTTTACCTCA
hsa-miR-675 16.5677 -28.45 3.460450e-02 3.401260e-02 1.618710e-02 318 339
gUGACACCCGGGAGAGGCGUGGu
 :|||| ||: :|| |||||:|
aGCTGT-GGTGTTCACCGCATCc
hsa-miR-582-3p 16.5396 -14.96 2.750120e-02 2.712650e-02 2.712650e-02 8 29
ccaagucaacaAGUUGGUCAAu
           ||||||||||
agaaaaagaacTCAACCAGTTt
bta-let-7d 16.5396 -22.85 5.905960e-02 4.338330e-03 1.228380e-06 53 74
uugauacguUGGAUGAUGGAGA
         :||||||:|||||
gtttcaaatGCCTACTGCCTCT
hsa-miR-621 16.5149 -12.3 2.251850e-02 2.226690e-02 3.130470e-03 301 321
uccAUUCGCGACAACGAUCGG
   |:: |  | ||||||||:
ctaTGGACTATTTTGCTAGCT
hsa-miR-130b 16.4329 -17.82 4.982970e-02 4.982970e-02 3.449060e-02 112 133
uacgggaaagUAGUAACGUGAC
          || :||||||||
gcaactcggaATAGTTGCACTG
bta-let-7c 16.4329 -22.01 7.345770e-02 4.338330e-03 1.228380e-06 54 74
uuGGUAUGUUGGAUGAUGGAGu
  :|| |: :||||||:||||
ttTCAAAT-GCCTACTGCCTCt
bta-let-7b 16.4329 -23.07 7.893830e-02 4.338330e-03 1.228380e-06 54 74
uuGGUGUGUUGGAUGAUGGAGu
  :|| |: :||||||:||||
ttTCAAAT-GCCTACTGCCTCt
hsa-miR-522 16.4329 -13.22 6.806630e-02 6.580150e-02 4.005830e-02 163 184
ugugaGAUUUCCCUUGGUAAAA
     | |||  ||:|||||||
atcaaCAAAATTGAGCCATTTT
bta-let-7a 16.3262 -17 7.728860e-02 4.338330e-03 1.228380e-06 224 246
uUGAUAUG-UUGGAUGAUGGAGU
 |||: || :| :| :|||||||
cACTGGACTGAATTTTTACCTCA
bta-miR-29c 16.3262 -14.54 4.109080e-02 4.109080e-02 4.109080e-02 580 600
AUUGGCUAAAGUUUACCACGAu
|:|:|  |   :| |||||||
TGATCTCTACAGACTGGTGCT-
bta-let-7f 16.3262 -16.71 7.121940e-02 4.338330e-03 1.228380e-06 224 246
uUGAUAUG-UUAGAUGAUGGAGU
 |||: || :| :| :|||||||
cACTGGACTGAATTTTTACCTCA
hsa-miR-512-3p 16.3262 -16.36 5.944140e-02 5.770930e-02 3.330360e-03 134 154
cUGGAGUCGAUACUGUCGUGAa
 |:||   || | ||||||||
aATCTATACT-TCACAGCACTg
hsa-miR-299-3p 16.3262 -22.17 4.633620e-02 4.527910e-02 4.527910e-02 21 42
UUCGCCAAAUGGUAGGGUGUau
|| | ||||:::|||||||:
AACCAGTTTGTTATCCCACGca
hsa-miR-518d-5p 16.2195 -19.39 6.733350e-02 6.511660e-02 3.756780e-02 57 78
gucuuucacgaAGGGAGAUCUC
           | |||||||||
caaatgcctacTGCCTCTAGAG
hsa-miR-454 16.1429 -14.8 6.763580e-02 6.539920e-02 3.514230e-04 110 133
ugggauauuCGUUAU-AACGUGAU
         | |||| |||||||:
cagcaactcGGAATAGTTGCACTG
bta-miR-140 16.1128 -18.15 6.290930e-02 6.097140e-02 2.220420e-04 304 327
aggcaccAAGAUGG--GACACCAU
       ||:|:|:  |||||||:
tggactaTTTTGCTAGCTGTGGTG
hsa-miR-130a 16.1128 -18.02 6.331260e-02 6.135000e-02 3.449060e-02 111 133
uacggGAAAAUUGU-AACGUGAC
     ||   ||:| ||||||||
agcaaCTCGGAATAGTTGCACTG
bta-let-7i 16.1128 -17.79 9.617060e-02 4.338330e-03 1.228380e-06 50 74
UUGUCGUGUUU---GAUGAUGGAGu
||:: : ||||   |||||:||||
AATGTTTCAAATGCCTACTGCCTCt
hsa-miR-329 16.0061 -13.54 4.860770e-02 4.744530e-02 2.251050e-03 380 401
uuucuccAAUUGGUCCACACAa
       | |:: :|||||||
tattcatTGAGTGGGGTGTGTg
bta-miR-34c 16.0061 -15.57 9.747780e-02 9.287750e-02 4.030300e-02 136 157
guuaGUCGAUUGAUGUGACGGA
    :| :| || :|||||:||
tctaTACTTCACAGCACTGTCT
mmu-miR-717 15.8994 -12.76 8.129030e-02 7.807400e-02 3.595100e-02 139 160
ucucuuccaUAGAGACAGACUc
         | | ||||||||
atacttcacAGCACTGTCTGAt
bta-miR-27a 15.8471 -18.3 9.786360e-02 9.322740e-02 8.691350e-03 490 509
gccUUGAAUCGGUGACACUU
   :|||| |||||||| ||
tctGACTTCGCCACTGTAAA
bta-miR-148a 15.7927 -16.01 6.993670e-02 2.868600e-03 8.258450e-06 112 134
uguuucaagacAUC-ACGUGACU
           ||| ||||||||
gcaactcggaaTAGTTGCACTGA
bta-miR-148b 15.686 -13.61 7.772590e-02 2.868600e-03 8.258450e-06 113 134
uguuucaagacaCUACGUGACU
            | ||||||||
caactcggaataGTTGCACTGA
hsa-miR-137 15.6119 -9.78 8.627980e-02 8.266250e-02 3.780500e-02 173 197
GAUGCGCAUAAGAA--UUCGUUAUU
:|: ||   ||:||  |||:||||:
TTGAGCCATTTTTTAAAAGTAATAG
hsa-miR-152 15.5497 -12.83 9.967820e-02 4.649760e-03 5.520280e-06 114 134
gguucaagacaguACGUGACU
             ||||||||
aactcggaatagtTGCACTGA
hsa-miR-891a 14.4055 -18.74 8.680560e-02 8.314470e-02 4.983330e-03 109 130
aGUCACCGAGUCCAAGCAACGU
 |||   |||:|  | ||||||
cCAGCAACTCGGAATAGTTGCA
Features
EntrezGene 528046
RefSeq_dna_predicted XM_606455
RefSeq_peptide_predicted XP_606455
spacer
spacer