spacer

Target Detailed View


Hit information for ENSBTAT00000018977

Gene Name LOC510218
Transcript ENSBTAT00000018977
Gene ENSBTAG00000014284
Description
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
hsa-miR-609 17.6032 -16.46 1.500300e-02 1.489100e-02 2.019990e-03 52 70
UCUCUACUCUCUUUGUGGGA
||| ||  || |||||||||
AGAAATCTGA-AAACACCCT
mmu-miR-466c-5p 17.3187 -20.77 3.467850e-02 2.112400e-03 1.579070e-13 494 515
auacaUGUACGUGUGUGUGUAG
     |:  |||| ||||||||
ttcccATCGGCACTCACACATC
mmu-miR-466f-3p 17.1911 -19.22 3.180480e-02 2.112400e-03 1.579070e-13 266 286
cACACAUACACACACACAUAc
 | |||:| ||| |||||:|
tTATGTGTCTGTCTGTGTGTc
hsa-miR-760 17.1738 -21.19 7.191480e-02 6.938980e-02 5.175980e-03 164 183
aggggUGUCUGGGUCUCGGC
     |::| ::||||||||
ctgagATGGTTTCAGAGCCG
mmu-miR-466a-3p 17.1315 -19.64 3.720510e-02 2.112400e-03 1.579070e-13 264 286
agAAUACACACGCACAUACAUAu
  |||||||| :|| |:|||:|
cgTTATGTGTCTGTCTGTGTGTc
mmu-miR-466b-3-3p 17.1315 -19.9 3.743730e-02 2.112400e-03 1.579070e-13 264 286
agAAUACACACGCACAUACAUAa
  |||||||| :|| |:|||:|
cgTTATGTGTCTGTCTGTGTGTc
mmu-miR-466d-3p 16.9776 -18.98 3.980460e-02 2.112400e-03 1.579070e-13 266 286
GAUACACACGCACAUACAUAu
:||||||| :|| |:|||:|
TTATGTGTCTGTCTGTGTGTc
hsa-miR-766 16.8937 -22.5 4.932190e-02 4.812530e-02 2.883040e-03 448 470
cgaCUCCGAC-ACCCCGACCUCa
   || |||| ||  |||||||
gacGATGCTGTTGTAGCTGGAGg
hsa-miR-769-3p 16.8143 -27.23 4.909400e-02 4.790840e-02 4.790840e-02 356 378
uugguucUGGGGCCUCUAGGGUC
       |||:|| :|||:||||
ccttctaACCTCGAGGATTCCAG
mmu-miR-677 16.7874 -18.26 5.025870e-02 4.901660e-02 4.901660e-02 7 28
aGUCUUCGAUUAGUAGUGACUu
 ||  | ||||| :||||||:
cCATTAACTAATGGTCACTGGc
hsa-miR-876-5p 16.6812 -21.5 5.191470e-02 5.059020e-02 5.170130e-03 218 239
acCACUAAGUGUUUCUUUAGGu
  || | ||:||||||::|||
ctGTCAGTCGCAAAGAGGTCCt
mmu-miR-466g 16.6573 -16.88 3.165540e-02 2.112400e-03 1.579070e-13 263 283
acacACACGUACACAGACAUA
    | ||::| |||||||:|
acgtTATGTGTCTGTCTGTGT
hsa-miR-516a-5p 16.6028 -23.13 2.405020e-02 2.376330e-02 4.851910e-03 350 372
cuuucacGAAGAAAGGAGCUCUU
       |||||  |||||||:|
caaccgcCTTCTAACCTCGAGGA
bta-miR-21* 16.5749 -20.03 6.892470e-02 6.660300e-02 7.403980e-03 138 159
ucugucgGGUAGCUGACGACAa
       ||:||  |||||||
tccaaaaCCGTCACCTGCTGTc
hsa-miR-629 16.5505 -15.97 4.207370e-02 4.120090e-02 1.348050e-02 525 545
uCAAGAGGGUUGCAUUUGGGU
 ||||| :: |  |||||:||
cGTTCTGTTTAATTAAACTCA
mmu-miR-466e-5p 16.4687 -15.6 6.640460e-02 2.112400e-03 1.579070e-13 494 515
auacaUGUACAUGUGUGUGUAG
     |:  | || ||||||||
ttcccATCGGCACTCACACATC
mmu-miR-466b-5p 16.4687 -15.68 6.645010e-02 2.112400e-03 1.579070e-13 494 515
guacaUGUACAUGUGUGUGUAG
     |:  | || ||||||||
ttcccATCGGCACTCACACATC
hsa-miR-551a 16.4437 -19.25 3.721160e-02 3.721160e-02 3.721160e-02 410 430
ACCUUUGGUUCUCACCCAGCg
|| |  ||:  | |||||||
TGAACTCCGTCACTGGGTCGa
bta-miR-19b 16.2855 -15.51 5.214660e-02 5.214660e-02 7.686000e-08 236 257
AGUCAAAACGUACCUAAACGUGU
||   ||||:: |  |||||||:
TCCTGTTTGTG-GCCTTTGCACG
hsa-miR-672 16.2855 -19.16 8.397980e-02 8.055020e-02 1.543800e-03 346 368
AGUGUGUGUCAUGUGGUUGGAGU
||||  || |  : |:||||||:
TCACCAACCGCCTTCTAACCTCG
hsa-miR-551b 16.0166 -21.38 4.653660e-02 4.547040e-02 4.547040e-02 409 430
gACUUUGGUUCAU-ACCCAGCg
 |||| :| :  | |||||||
gTGAACTCCGTCACTGGGTCGa
bta-miR-19a 15.9683 -12.8 7.644940e-02 7.360020e-02 7.686000e-08 236 257
AGUCAAAACGUAUCUAAACGUGU
||   ||||:: :  |||||||:
TCCTGTTTGTG-GCCTTTGCACG
hsa-miR-575 15.7579 -17 8.576860e-02 8.219340e-02 5.662680e-04 13 30
cGAGGACAGGUUGACCGAg
 ||  || :| |||||||
aCTAATGGTC-ACTGGCTg
mmu-miR-434-5p 15.7249 -20.87 4.012240e-02 3.932820e-02 3.932820e-02 411 432
accaAGUUUGGUACUCAGCUCG
    || : |  ||:|||||||
gaacTCCGTCACTGGGTCGAGC
mmu-miR-690 15.4062 -15.79 8.817970e-02 8.440370e-02 8.509760e-03 231 252
aaaCCAACACUCGGAUCGGAAA
   |||  ||  : |:||||||
agaGGTCCTGTTTGTGGCCTTT
bta-miR-210 15.3338 -23.47 8.569370e-02 8.212470e-02 7.217140e-03 64 86
agucggcgacagugUGCGUGUCa
              ||||||||
acaccctggagggaACGCACAGc
bta-miR-450 15.2999 -13.85 8.288990e-02 7.954750e-02 1.069410e-02 211 232
uauaauccuugugUAGCGUUUU
             :|||||||:
ggacccactgtcaGTCGCAAAG
mmu-miR-463 15.1937 -15.85 9.157770e-02 8.750960e-02 1.087040e-02 261 279
gaUGGAAUAUACCACAGAUAGu
  || ||||   ||||||:||
tcACGTTAT---GTGTCTGTCt
hsa-miR-371-3p 14.805 -14.26 9.563580e-02 9.120510e-02 1.005470e-04 486 508
ugugaguuuucuaccGCCGUGAa
               |||||||
caggccatttcccatCGGCACTc
bta-miR-99a 14.7353 -14.19 6.088420e-02 5.906780e-02 1.341400e-03 187 207
uguuCUAGCCUAGAUGCCCaa
    || | || :||||||
tggcGACCAGACTTACGGGag
mmu-miR-341 14.0946 -16.96 9.468160e-02 9.033750e-02 2.891960e-03 384 404
uGGCUGGCUGGCUAGCUGGCU
 || ||:| :  |||||| |:
tCCAACTGCTACATCGACAGG
Features
AFFY_Bovine Bt.26096.1.A1_at
EntrezGene 510218
RefSeq_dna_predicted XM_587341
RefSeq_peptide_predicted XP_587341
UniGene Bt.77927
UniGene Bt.78359
spacer
spacer