spacer

Target Detailed View


Hit information for ENSBTAT00000014882

Gene Name GALT1_BOVIN
Transcript ENSBTAT00000014882
Gene ENSBTAG00000011206
Description Polypeptide N-acetylgalactosaminyltransferase 1 (EC 2.4.1.41) (Protein-UDP acetylgalactosaminyltransferase 1) (UDP- GalNAc:polypeptide N-acetylgalactosaminyltransferase 1) (Polypeptide GalNAc transferase 1) (GalNAc-T1) (pp-GaNTase 1) [Contains: Polypeptid [Source:Uniprot/SWISSPROT;Acc:Q07537]
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
hsa-miR-505 17.812 -19.2 1.008870e-02 1.003800e-02 4.119380e-03 158 179
UCCUUUGGUCGUUCACAACUGC
|| |: : | | ||||||||||
AGTAGTTAAACTAGTGTTGACG
hsa-miR-520a-5p 17.582 -24.51 3.007460e-02 2.962690e-02 1.650130e-03 348 368
ucuuucAUGAAGGGAGACCUC
      |:|| :|||||||||
tatcttTGCTCTCCTCTGGAG
hsa-miR-298 17.2324 -28.38 4.263690e-02 4.174070e-02 4.174070e-02 426 446
accCUCUUGGAGGGACGAAGACGA
   | ||||||||   ||||||||
ccaGTGAACCTCC---CTTCTGCT
mmu-miR-706 17.1796 -17.78 2.688900e-02 2.653070e-02 3.860590e-03 504 524
aAAAAACUCUGUCCCAAAGAGA
 | ||  :||:| |||||||||
aTCTTCCGGATA-GGTTTCTCT
hsa-miR-525-5p 17.0525 -24.61 4.779370e-02 4.666960e-02 4.805630e-03 348 368
ucuuucACGUAGGGAGACCUC
      |||  :|||||||||
tatcttTGCTCTCCTCTGGAG
hsa-miR-922 16.8897 -26.71 4.600450e-02 4.496230e-02 4.496230e-02 217 241
cuGCAU-CAGGA-UAAGAGACGACG
  :||: ||||| |  ||||||||:
ccTGTGTGTCCTCAAGCTCTGCTGT
mmu-miR-742 16.8635 -25.86 3.650500e-02 3.584670e-02 3.584670e-02 539 558
aaauGGGUCGUACCACCGAAAG
    |||||||   ||||||||
tgctCCCAGCA--CTGGCTTTC
hsa-miR-134 16.8635 -24.29 3.648810e-02 3.583040e-02 3.583040e-02 190 212
gGGGAGACCAGUUG-GUCAGUGu
 :||||  ||:| : |||||||
gTCCTCGTGTTACTACAGTCACt
rno-miR-336 16.8406 -15.11 3.412390e-02 3.354820e-02 3.354820e-02 1 19
ucUGAUCUAUACCUUCCCACu
  |:|: :|:|  |||||||
--ATTGTGTGTCAAAGGGTGt
hsa-miR-936 16.7581 -29.64 4.513020e-02 4.412700e-02 4.412700e-02 218 241
GACGCUAAGGAG--GGAGAUGACA
|||:|  |||||   ||||:||||
CTGTGTGTCCTCAAGCTCTGCTGT
mmu-miR-466a-5p 16.6527 -16.17 5.897150e-02 5.897150e-02 2.364180e-05 121 144
aUACAUGUACAUGU--GUGUGUAU
 ||||| ||  | |  |||||||:
aATGTAAATTAAAAAGCACACATG
hsa-miR-518d-5p 16.5473 -23.73 4.980740e-02 4.858740e-02 2.393050e-05 347 368
gucuuucACGAAGGGAGAUCUC
       |||| :|||||:|||
ttatcttTGCTCTCCTCTGGAG
mmu-miR-466c-5p 16.4419 -13.97 7.086350e-02 6.841100e-02 2.364180e-05 121 144
aUACAUGUACGUGU--GUGUGUAg
 ||||| ||  | |  |||||||
aATGTAAATTAAAAAGCACACATg
mmu-miR-466b-5p 16.4419 -13.87 6.790360e-02 6.790360e-02 2.364180e-05 121 144
gUACAUGUACAUGU--GUGUGUAg
 ||||| ||  | |  |||||||
aATGTAAATTAAAAAGCACACATg
mmu-miR-466e-5p 16.4419 -13.97 6.785440e-02 6.785440e-02 2.364180e-05 121 144
aUACAUGUACAUGU--GUGUGUAg
 ||||| ||  | |  |||||||
aATGTAAATTAAAAAGCACACATg
hsa-miR-616 16.4419 -18.61 5.367770e-02 5.226250e-02 7.334770e-03 325 346
GACGAGUUUGGGAGGUUACUGA
|| |||  :::: :||:|||||
CTCCTCCTGTTTGTCAGTGACT
hsa-miR-562 16.3958 -10.99 4.545090e-02 4.443350e-02 4.443350e-02 575 594
cGUUUACCAUGUCGAUGAAa
 ||:|   |:: |||||||
aCAGACTTTGTTGCTACTTc
bta-miR-122 16.3365 -14.93 5.566110e-02 5.414040e-02 1.973150e-03 81 102
guuUGUGGUAACAGUGUGAGGu
   | |:::|| |:|:|||||
atcAAATTGTTCTTATACTCCc
mmu-miR-692 16.3111 -26.03 7.870840e-02 7.569060e-02 5.729060e-03 391 411
CUCACUCCGCGAGUUUCUCUa
| ||| ||:||||| |||||
GTGTGTGGTGCTCACAGAGAg
hsa-miR-569 16.3111 -13.37 4.896710e-02 4.778750e-02 4.778750e-02 293 313
ugaaAGGUCCUAAGUAAUUGa
    | :||| ||||||||:
aacaTGTAGGTTTCATTAATg
hsa-miR-892b 16.1257 -32.26 7.733400e-02 7.441930e-02 2.112810e-03 237 258
aGAUGGGUCUUUCCUCGGUCAC
 ||::|||| : |||| |||||
gCTGTCCAGTGTGGAGGCAGTG
bta-let-7i 16.1257 -21.04 9.497300e-02 9.060250e-02 2.037200e-07 574 595
UUGUCGUGUUUGAUGAUGGAGU
:||||  :  ::|:||||:||:
GACAGACTTTGTTGCTACTTCG
hsa-miR-802 16.0505 -14.77 6.983660e-02 2.721790e-03 2.721790e-03 568 590
uguuCCUACUUAGAAACAAUGAc
    ||:  |: |||||||:||
cgttGGGACAGACTTTGTTGCTa
bta-miR-20a 16.0505 -15.96 9.105230e-02 8.703000e-02 7.574230e-03 16 39
gAUGGACGUGAUA-UUCGUGAAAU
 |:: | |  ||| |||:||||||
gTGTATACTATATAAAGTACTTTA
mmu-miR-763 16.0203 -20.8 9.329420e-02 8.907450e-02 2.223710e-03 453 474
cggugaccaaGAAGGGUCGACc
          | |||||||||
acccaactaaCCTCCCAGCTGa
hsa-miR-802 15.9456 -14.12 7.565890e-02 2.721790e-03 2.721790e-03 180 204
uGUUCCUACUUAGAA--ACAAUGAc
 ||:   ||::|| |  |||||||
cCAGTCCTGGGTCCTCGTGTTACTa
hsa-miR-611 15.9456 -28.37 4.515100e-02 4.414690e-02 4.414690e-02 175 197
cagucuggggcucCCCAGGAGCG
             |||||||||:
tgacgccagtcctGGGTCCTCGT
hsa-miR-575 15.8435 -24.23 7.970390e-02 7.661030e-02 5.869130e-03 534 556
cGAGGAC-A-GGU--UGACCGAG
 ||:||| | |||  |||||||:
tCTTCTGCTCCCAGCACTGGCTT
hsa-miR-512-3p 15.8095 -18.41 9.591840e-02 9.146190e-02 8.365270e-03 530 552
cuGGAGUCGAU-ACUGUCGUGAa
  :|||  ||: |  |||||||
ttTCTCTTCTGCTCCCAGCACTg
hsa-miR-582-3p 15.7041 -15.35 6.020630e-02 5.842970e-02 1.370910e-03 153 174
cCAAGUCAACAAGUUGGUCAau
 || |||| ||| |||:|||
tGTCCAGTAGTTAAACTAGTgt
hsa-miR-891a 15.3879 -18.89 3.594010e-02 3.530190e-02 3.530190e-02 567 589
aGUCACCGAGUC-CAAGCAACGu
 |: |||  |||  ||:|||||
aCGTTGGGACAGACTTTGTTGCt
hsa-miR-339-3p 14.6867 -19.94 9.782720e-02 9.319440e-02 3.328970e-03 381 404
gccgagacaGCA-GCUCCGCGAGU
         ||| :| ||:|||||
tgcagcaccCGTGTGTGGTGCTCA
Features
EMBL L07780
EMBL L17437
EntrezGene 282241
GO GO:0004653
GO GO:0005509
GO GO:0005529
GO GO:0006493
GO GO:0016020
GO GO:0016021
GO GO:0016740
GO GO:0016757
GO GO:0030145
protein_id AAA30532
protein_id AAA68489
RefSeq_dna NM_177519
RefSeq_peptide NP_803485
UniGene Bt.28224
UniGene Bt.65693
Uniprot/SWISSPROT Q07537
spacer
spacer