spacer

Target Detailed View


Hit information for ENSBTAT00000014479

Gene Name PDE5A_BOVIN
Transcript ENSBTAT00000014479
Gene ENSBTAG00000024888
Description cGMP-specific 3',5'-cyclic phosphodiesterase (EC 3.1.4.35) (CGB-PDE) (cGMP-binding cGMP-specific phosphodiesterase). [Source:Uniprot/SWISSPROT;Acc:Q28156]
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
hsa-miR-509-3-5p 18.761 -21.51 6.227350e-03 6.227350e-03 1.984230e-04 29 50
guaCUAACGGUGCAGACGUCAU
   ||| |:  | |||||||||
acaGATGGTGTCTTCTGCAGTA
hsa-miR-509-5p 18.4036 -19.21 9.338180e-03 9.294710e-03 1.984230e-04 31 50
aCUAACGGUGACAGACGUCAU
 ||| |:  || |||||||||
aGATGGTGTCT-TCTGCAGTA
hsa-miR-559 18.1749 -9.59 3.254480e-02 1.089170e-03 1.089170e-03 97 117
aaaACCACGUAUAAAUGAAAu
   || ||:|| ||||:|||
cacTGCTGTATTTTTATTTTt
hsa-miR-130b 17.8514 -13.64 1.501060e-02 1.501060e-02 1.176330e-02 102 123
uACGGGAAAGUAGUAACGUGac
 ||: :|||:||: ||||||
cTGTATTTTTATTTTTGCACaa
bta-let-7a* 17.7177 -12.68 2.095660e-02 2.073850e-02 2.073850e-02 71 91
cuuUCUGUCAUCUAACAUAUc
   | | | | |:|||||||
tgtACAGATTTGGTTGTATAc
hsa-miR-216a 17.624 -18.31 1.204290e-02 1.197070e-02 5.817320e-05 186 207
AGUGUCAACGGUCGACUCUAAU
|:|::    : | |||||||||
TTATGCCACTGAACTGAGATTA
hsa-miR-559 17.6034 -9.13 4.741480e-02 1.089170e-03 1.089170e-03 168 188
aAAACCACGUAUAAAUGAAAU
 |||  ||:| ||||::||||
aTTTTCTGTACATTTGTTTTA
hsa-miR-144 17.5872 -12.66 2.370680e-02 2.342800e-02 2.342800e-02 56 74
UCAUGUAGUAGAUAUGACAU
||| : |  | |||||||||
AGT-TTTGCTATATACTGTA
bta-miR-19a 17.5354 -12.48 2.212640e-02 2.212640e-02 6.163800e-06 101 122
aGUCAAAACGUAUCUAAACGUGU
 | || || : ||  ||||||||
gCTGTATT-TTTATTTTTGCACA
mmu-miR-743b-3p 17.5103 -15.98 3.500240e-02 3.439690e-02 1.059230e-02 130 153
aGAUAAGUCGUAC--UACAGAAAg
 | :| :||||||  ||||:|||
aCAGTGTAGCATGAAATGTTTTTa
hsa-miR-301a 17.3091 -14.77 2.541620e-02 2.921340e-03 6.544830e-05 147 169
CGAAACUGUUAUGAUAACGUGac
|:||| | |: |||||||||:
GTTTTTAGAGGACTATTGCATat
bta-miR-21* 17.2829 -14.43 3.904170e-02 3.828940e-02 3.828940e-02 86 106
ucUGUCGGGUAGCUGACGACAa
  |:| :::: | ||||||||
gtATACTTTG-CCACTGCTGTa
hsa-miR-130a 17.2829 -11.42 2.366610e-02 2.338830e-02 1.176330e-02 102 123
uACGGGAAAAUUGUAACGUGac
 ||: :||||| : ||||||
cTGTATTTTTATTTTTGCACaa
mmu-miR-464 17.0828 -13.56 2.578640e-02 2.545680e-02 5.464710e-04 64 85
AUAGAGUGUCUUAUUUGAACCAu
||| | || | | |:|:|||||
TATAT-ACTGTACAGATTTGGTt
bta-miR-19b 16.8566 -11.03 3.284990e-02 3.231620e-02 6.163800e-06 102 122
agucaAAACGUACCUAAACGUGU
     ||| :||   ||||||||
ctgtaTTTTTAT--TTTTGCACA
hsa-miR-206 16.8281 -16.63 4.740090e-02 4.629500e-02 4.629500e-02 162 184
GGUGUGUGAAGGA-AUGUAAGgu
:::||:|:||:|| ||||||:
TTGCATATTTTCTGTACATTTgt
bta-miR-221 16.8281 -17.65 2.787710e-02 2.749210e-02 7.903240e-03 119 140
uuugggucguCUGUUACAUCGa
          ||||:||||||
cacaatttttGACAGTGTAGCa
hsa-miR-548a-3p 16.6007 -16.24 6.159130e-02 5.973290e-02 1.090470e-03 42 62
cGUUUUCAUUAACGGUCAAAAC
 | : ||| ||  |:|||||||
tCTGCAGT-ATGCCTAGTTTTG
hsa-miR-508-5p 16.5172 -25.08 5.856160e-02 5.687990e-02 4.864090e-03 28 50
guacucACUGCGGGAGACCUCAU
      ||::|:|:|||| ||||
gacagaTGGTGTCTTCTGCAGTA
mmu-miR-759 16.487 -16.88 4.387350e-02 4.292500e-02 3.817470e-04 73 96
caGUUUUAACAAAC--GUGAGACG
  ||:| ||| |||  :|||:|||
taCAGATTTGGTTGTATACTTTGC
hsa-miR-576-3p 16.3733 -11.5 6.101340e-02 3.188050e-03 1.230680e-03 105 126
cUAAGGUUAAAAAGGUGUAGAA
 |||:: |||||| |||| :||
tATTTTTATTTTTGCACAATTT
mmu-miR-678 16.2596 -15.45 3.737490e-02 3.668510e-02 6.375740e-03 184 205
GGAGGUCAGGAACGUGGCUCUG
::|:  | |  || ||:||||:
TTTTATGCCACTGAACTGAGAT
hsa-miR-491-3p 16.2596 -12.11 3.848560e-02 3.775440e-02 5.767270e-03 149 170
caucUUCCCUUAGAACGUAUuc
    |: ||| | |||||||
ttttAGAGGACTATTGCATAtt
hsa-miR-598 16.2596 -16.33 2.348690e-02 2.321320e-02 7.331790e-04 21 40
ACUGCUACUGUUGCUACUGCAu
||| | |||||  ||||::||
TGAAGTTGACA--GATGGTGTc
hsa-miR-301b 16.0647 -9.89 6.957400e-02 2.921340e-03 6.544830e-05 147 169
CGAAACUGUUAUAGUAACGUGac
|:||| | |: | :||||||:
GTTTTTAGAGGACTATTGCATat
hsa-miR-217 16.0647 -18.72 4.871660e-02 4.754900e-02 4.754900e-02 28 50
agGUUAGUCAAGGACUACGUCAU
  ||: ::|| :||  |||||||
gaCAGATGGTGTCTTCTGCAGTA
hsa-miR-576-3p 16.0322 -9.58 8.205700e-02 3.188050e-03 1.230680e-03 160 183
cUAAGGU-UAAAA-AGGUGUAGAa
 ||| || ||||| | :||||:|
tATTGCATATTTTCTGTACATTTg
mmu-miR-883b-5p 16.0322 -19.62 8.953600e-02 8.564470e-02 9.155270e-03 156 177
aCUGACGAUGGGUAAGAGUCAU
 |||| :|:| :|||:|| |||
gGACTATTGCATATTTTCTGTA
hsa-miR-301b 15.9515 -10.1 7.641540e-02 2.921340e-03 6.544830e-05 101 123
CGAAACUGUUAUAGUAACGUGac
||| |  :  |||: ||||||
GCTGTATTTTTATTTTTGCACaa
hsa-miR-301a 15.9515 -10.89 7.845610e-02 2.921340e-03 6.544830e-05 101 123
CGAAACUGUUAUGAUAACGUGac
||| |  :  ||:| ||||||
GCTGTATTTTTATTTTTGCACaa
bta-miR-199a-3p 15.9185 -12.84 7.156490e-02 4.469790e-03 1.867740e-05 85 105
AUUGGUUACACGUCUGAUGACA
|:  :| | |||  |||:||||
TGTATACTTTGC-CACTGCTGT
hsa-miR-219-2-3p 15.9185 -9.32 7.737140e-02 7.445400e-02 1.512580e-03 106 127
ugucuACAGGUCGGUGUUAAGA
     | |::   |||||||:|
attttTATTTTTGCACAATTTT
hsa-miR-152 15.8888 -18.23 7.415200e-02 7.146950e-02 6.914930e-03 53 73
GGUUCAAGACAGUACGUGACu
|| ||||:|| :|| :||||
CCTAGTTTTGCTATATACTGt
hsa-miR-208b 15.8047 -11.99 4.729380e-02 4.729380e-02 4.729380e-02 164 189
UGUUUGGAAAAC----AAGCAGAAUA
:|| |::|| ||    ||:||:||||
GCATATTTTCTGTACATTTGTTTTAT
hsa-miR-506 15.7745 -17.11 7.241100e-02 6.985150e-02 8.474790e-03 24 43
agaugaGUCUUCCCACGGAAu
      ||| | ||||:|||
agttgaCAG-ATGGTGTCTTc
hsa-miR-147b 15.691 -14.45 4.742450e-02 3.237000e-03 3.237000e-03 102 123
aucgucuucGUAAAGGCGUGUg
         :||||::|||||
ctgtattttTATTTTTGCACAa
cfa-miR-448 15.691 -16.31 9.639390e-02 9.189380e-02 1.022140e-02 33 55
UACCCUGUAGGAUG-UAUACGuu
|||| :: |:||:| :|||||
ATGGTGTCTTCTGCAGTATGCct
bta-miR-199a-3p 15.5773 -13.06 9.766510e-02 4.469790e-03 1.867740e-05 144 165
auugguuacaCGUCUGAUGACa
          | :|||||:||
aatgtttttaGAGGACTATTGc
hsa-miR-923 15.5459 -12.29 6.382150e-02 2.940370e-03 8.738670e-04 178 198
ucAAAGAAAAGGAGGCGACUg
  ||| |||| : || ||||
caTTTGTTTTATGCCACTGAa
hsa-miR-923 15.3173 -16.49 7.871800e-02 2.940370e-03 8.738670e-04 86 106
ucaAAGAAAAGGAGGCGACug
   | |||| || |:||||
gtaTACTTTGCCACTGCTGta
hsa-miR-147b 15.1225 -14.3 8.270220e-02 3.237000e-03 3.237000e-03 159 180
aucgucuucguAAAGGCGUGUG
           ||||:|:|||:
ctattgcatatTTTCTGTACAT
bta-miR-126 15.0886 -7.55 4.229820e-02 4.141610e-02 7.548980e-03 56 76
gCGUAAUAAUGAGUGCCAUGc
 |: ||: ||: :|| ||||
aGTTTTGCTATATACTGTACa
hsa-miR-220 14.7457 -14.71 8.929850e-02 8.542750e-02 7.297850e-03 22 41
UUUCACAGUCUAUGCCACAcc
:|||| | | | |:|||||
GAAGT-TGACAGATGGTGTct
Features
AFFY_Bovine Bt.540.1.S1_at
EMBL L16545
EntrezGene 785098
EntrezGene 281972
GO GO:0000166
GO GO:0000287
GO GO:0003824
GO GO:0004112
GO GO:0004114
GO GO:0007165
GO GO:0008270
GO GO:0016787
GO GO:0030553
GO GO:0046069
GO GO:0046872
GO GO:0047555
PDB 1FL4
protein_id AAB00990
RefSeq_dna NM_174417
RefSeq_dna_predicted XM_001253229
RefSeq_peptide NP_776842
RefSeq_peptide_predicted XP_001253230
UniGene Bt.540
Uniprot/SWISSPROT Q28156
spacer
spacer