spacer

Target Detailed View


Hit information for ENSBTAT00000012490

Gene Name LOC531942
Transcript ENSBTAT00000012490
Gene ENSBTAG00000009493
Description
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
hsa-miR-765 18.9518 -26.68 2.376640e-02 2.348620e-02 2.479110e-03 274 294
GUAGUGGAAGGAAGAGGAGGu
|:|:  :||||||||||||:
CGTTCATTTCCTTCTCCTCTc
bta-miR-455 18.7262 -20.36 3.573310e-03 3.566930e-03 4.904080e-06 121 140
CUACAUCAGGUUUCCGUGUAU
||| | |  ||:|||||||||
GAT-TTGCACAGAGGCACATA
bta-miR-19b 18.6476 -19.4 7.569770e-03 7.569770e-03 6.156130e-06 106 130
agucAAAACGUA--CCUAAACGUGU
    || || ||  |||||||||||
aatcTTCTGGATCAGGATTTGCACA
bta-miR-19a 18.3126 -16.46 1.185790e-02 1.178790e-02 6.156130e-06 106 130
agucAAAACGUA--UCUAAACGUGU
    || || ||  :||||||||||
aatcTTCTGGATCAGGATTTGCACA
hsa-miR-297 18.1621 -21.43 1.811010e-02 1.794710e-02 5.893580e-04 123 143
guACGUGUACGUGUGUAUGUA
  ||||||   :||||||:||
ttTGCACAGAGGCACATATAT
hsa-miR-665 18.0358 -30.2 2.710020e-02 2.673630e-02 7.108000e-04 51 71
uCCCCGGAGUC-GGAGGACCa
 | ||  |||| ||||||||
tGTGGGGTCAGCCCTCCTGGa
hsa-miR-9 17.9776 -23.44 1.756390e-02 1.741060e-02 9.870110e-04 293 316
AGUAUGUCGAUC-UAUUGGUUUCU
||  | |||||| : ||||||:||
TCCCAGAGCTAGTGGAACCAAGGA
hsa-miR-486-3p 17.9365 -20.82 2.771250e-02 2.733200e-02 2.870840e-03 250 270
uAGGACAUGACUCGACGGGGc
 |:: || : || |||||||
cTTTCGTCTGGAACTGCCCCc
mmu-miR-759 17.6184 -17.76 1.468590e-02 3.216900e-03 3.216900e-03 319 340
caguuuuaacAAACGUGAGACG
          | ||||||||||
agctctccctTCTGCACTCTGC
hsa-miR-298 17.5592 -21.91 3.227800e-02 3.176260e-02 2.829040e-04 310 334
acccUCUUGGAGGGA-CGAAGACGa
    :||||  |:||  |||||||
ccaaGGAACAGCTCTCCCTTCTGCa
mmu-miR-883a-5p 17.394 -16.86 2.564230e-02 4.875510e-04 4.875510e-04 212 233
cAUUGACGAUGAAGAGAGUCgu
 | ||| | |:||:||||||
cTTACTCCCATTTTTCTCAGgc
hsa-miR-607 17.3725 -16.81 3.388670e-02 3.331900e-02 3.331900e-02 109 129
cAAUAUCUAGACCUAAACUUG
 || |:|||| ||||||| ||
cTTCTGGATCAGGATTTGCAC
bta-miR-27a 17.3552 -14.43 2.739600e-02 2.739600e-02 2.999350e-05 61 80
gccuuGAAUCGGUGACACUU
     | |:|  ||||||||
gccctCCTGGAAACTGTGAA
bta-miR-27b 17.2597 -15.26 3.206210e-02 3.155360e-02 2.999350e-05 60 80
cgucuuGAAUCGGUGACACUU
      | |:|  ||||||||
agccctCCTGGAAACTGTGAA
hsa-miR-640 17.2597 -14.87 1.524390e-02 1.512830e-02 3.384270e-03 100 120
ucuccGUCCAAGGACCUAGUa
     ||   |:||||||||
nnntcCAATCTTCTGGATCAg
hsa-miR-198 17.1695 -26.49 3.974520e-02 1.343530e-03 1.343530e-03 315 336
CUUGGAUAGAGGGGAGACCUGG
||||   ||||||:|||| ||:
GAACAGCTCTCCCTTCTGCACT
mmu-miR-883a-5p 17.1695 -18.01 3.155640e-02 4.875510e-04 4.875510e-04 148 170
cauugacgauGAAG-AGAGUCGU
          |||| ||||||||
ccccaaccccCTTCTTCTCAGCA
hsa-miR-550 17.0843 -33.5 2.987150e-02 2.942980e-02 2.213170e-05 207 236
CCCGAGAAUGAGG-------GAGUCCGUGa
|| ||||||||||       ||||||||:
GGACTCTTACTCCCATTTTTCTCAGGCATc
mmu-miR-466a-5p 17.0573 -13.69 4.272050e-02 4.272050e-02 1.093290e-05 121 142
aUACAUGUACAUGUGUGUGUAU
 || |:||   | :||||:|||
gATTTGCACAGAGGCACATATA
hsa-miR-744 16.9451 -21.1 4.140080e-02 4.055550e-02 4.055550e-02 176 197
acgacaaucGGGAUCGGGGCGu
         :|: ||||||||
attcctccaTCTCAGCCCCGCc
hsa-miR-613 16.9014 -13.05 3.567600e-02 3.504710e-02 3.504710e-02 162 181
ccguuUCUUCCUUGUAAGGA
     || | |:|:||||||
ttctcAGCACGGATATTCCT
hsa-miR-198 16.8329 -22.18 5.275450e-02 1.343530e-03 1.343530e-03 242 263
cuuGGAUAGAGGGGAGACCUgg
   || :|||::| ||||||
ctcCCAGTCTTTCGTCTGGAac
hsa-miR-663 16.8329 -24.01 6.635720e-02 6.420350e-02 1.489440e-05 177 198
cgccAGGGCGCCGCGGGGCGGa
    |||  |   ||||||||
ttccTCCATCTCAGCCCCGCCc
hsa-miR-513-5p 16.7615 -21.02 6.014200e-02 5.836920e-02 2.530460e-02 39 56
uacuGUGGAGGGACACUU
    |:|: |||||||::
acctCGCTACCCTGTGGG
hsa-miR-769-3p 16.7493 -18.59 5.194480e-02 5.061870e-02 9.996440e-03 66 88
uuggUUCUGGGGCCUCUAGGGUc
    :| ||: :| |||||:||
cctgGAAACTGTGAAGATCTCAc
hsa-miR-924 16.6746 -13.99 5.241720e-02 5.106710e-02 1.170000e-02 194 213
cguucuGUAGUGUUCUGAGA
      || | ||:||||||
cgccccCAACCCAGGACTCT
hsa-miR-659 16.6085 -18.18 4.482310e-02 4.383340e-02 5.189960e-03 293 314
accccuggGAGGGACUUGGUUC
        ||  : ||||||||
tcccagagCTAGTGGAACCAAG
rno-miR-347 16.544 -19.84 6.280420e-02 6.087270e-02 2.530290e-04 22 41
ACCCG-CUGGGUCUCCCUGu
||| |  |:  :|||||||
TGGACTCATGAGGAGGGACc
mmu-miR-466c-5p 16.4962 -14.44 6.782210e-02 6.782210e-02 1.093290e-05 121 142
aUACAUGUACGUGUGUGUGUAg
 || |:||   | :||||:||
gATTTGCACAGAGGCACATATa
mmu-miR-466e-5p 16.4962 -13.35 6.494480e-02 6.494480e-02 1.093290e-05 121 142
aUACAUGUACAUGUGUGUGUAg
 || |:||   | :||||:||
gATTTGCACAGAGGCACATATa
mmu-miR-466b-5p 16.4962 -13.35 6.498660e-02 6.498660e-02 1.093290e-05 121 142
gUACAUGUACAUGUGUGUGUAg
 || |:||   | :||||:||
gATTTGCACAGAGGCACATATa
bta-miR-345 16.47 -23.53 4.948080e-02 4.827660e-02 4.209940e-03 41 62
ucGUGACCUGAU-CCUCAGUCG
  |:||   ||: ||:||||||
ctCGCTACCCTGTGGGGTCAGC
bta-miR-140 16.2718 -24.78 5.533680e-02 5.383360e-02 1.058210e-03 36 57
aggcaccaaGAUGGGACACCau
         |||||||||||
gggacctcgCTACCCTGTGGgg
hsa-miR-525-5p 16.2444 -14.29 9.351410e-02 8.927480e-02 1.502710e-04 97 117
ucuuucACGUAGGGAGACCUc
      | || :|:||||||
nnnnnnTCCAATCTTCTGGAt
mmu-miR-466d-5p 16.0474 -15.33 8.268100e-02 7.935520e-02 1.093290e-05 121 142
gUACAUGUACAUGCGUGUGUGU
 || |:||   | |||||:|:|
gATTTGCACAGAGGCACATATA
hsa-miR-892b 16.0474 -22.46 8.262340e-02 7.930220e-02 2.571810e-02 286 306
AGAUGGGUCUUUCCUCGGUCAC
||| |:|    | ||||:||||
TCTCCTCTCCCA-GAGCTAGTG
mmu-miR-695 16.0474 -24.9 6.174260e-02 5.987520e-02 1.269950e-03 227 251
aAGUCAGU-GGA-UA-CGGGUUAGA
 |||| || ||| :|  ||||:|||
cTCAGGCATCCTGGTCTCCCAGTCT
mmu-miR-697 15.906 -22.31 6.700700e-02 6.481130e-02 4.442760e-03 106 126
agAGGUGUCCUGGUCCUACAa
  ||: | |||:|||||| |
aaTCTTCTGGATCAGGATTTg
hsa-miR-611 15.856 -32.46 4.886490e-02 4.769020e-02 4.769020e-02 20 45
cAGUCUGGG-GCUC--CCCAGGAGCG
 |::|||:| :|||  ||| ||||||
cTTGGACTCATGAGGAGGGACCTCGC
mmu-miR-759 15.8229 -12.7 8.243780e-02 3.216900e-03 3.216900e-03 72 93
caguuuuaaCAAACGUGAGACg
         | |  |||||||
aactgtgaaGATCTCACTCTGn
mmu-miR-715 15.7931 -13.76 3.567740e-02 3.504850e-02 1.986440e-04 155 175
gugcgcccccacaCGUGCCUc
             |||||||
ccccttcttctcaGCACGGAt
bta-miR-380-5p 15.5985 -18.77 4.713680e-02 4.604310e-02 6.037450e-03 43 64
cgcguacaAGAUACCAGUUGGu
        | |: |||||:||
cgctacccTGTGGGGTCAGCCc
hsa-miR-585 15.2889 -16.09 4.958690e-02 4.837750e-02 2.806780e-03 134 152
aucGUAUGUCUAUGCGGGU
   ||||:|  ||| ||||
gcaCATATATTTACCCCCA
mmu-miR-344 14.8511 -11.58 9.647740e-02 9.196960e-02 1.751030e-03 97 119
ugucaguccgaaaccGAUCUAGU
               ||:|||||
nnnnnntccaatcttCTGGATCA
Features
AFFY_Bovine Bt.16930.1.A1_at
AFFY_Bovine Bt.16930.2.S1_at
EntrezGene 531942
GO GO:0000060
GO GO:0002268
GO GO:0002315
GO GO:0002455
GO GO:0002467
GO GO:0005515
GO GO:0005634
GO GO:0005737
GO GO:0006974
GO GO:0007249
GO GO:0008134
GO GO:0009615
GO GO:0010225
GO GO:0016481
GO GO:0019730
GO GO:0030198
GO GO:0030528
GO GO:0032729
GO GO:0042088
GO GO:0042345
GO GO:0042536
GO GO:0042742
GO GO:0042771
GO GO:0042832
GO GO:0043066
GO GO:0043234
GO GO:0045064
GO GO:0045082
GO GO:0045415
GO GO:0045727
GO GO:0045941
GO GO:0045944
GO GO:0048536
RefSeq_dna_predicted XM_610447
RefSeq_peptide_predicted XP_610447
UniGene Bt.16930
spacer
spacer