spacer

Target Detailed View


Hit information for ENSBTAT00000012034

Gene Name NP_001019863.1
Transcript ENSBTAT00000012034
Gene ENSBTAG00000009129
Description DNA polymerase iota [Source:RefSeq_peptide;Acc:NP_001019863]
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
hsa-miR-155 18.9878 -21.63 4.491520e-03 4.481450e-03 9.744830e-05 238 260
uggggAUAGUGCUAAUCGUAAUU
     |||||:||| |||||||:
aagaaTATCATGATCAGCATTAG
bta-miR-199b 18.3584 -20.43 8.929020e-03 8.929020e-03 8.929020e-03 269 291
cuUGUCUAUCAGAUUUGUGACCC
  |:| || ||  ||||||||||
ccATACATCGTGGAAACACTGGG
bta-miR-142* 17.4958 -20.2 2.584730e-02 2.551610e-02 2.551610e-02 266 288
guAGGUAUUUCAU-CCUUUGUGA
  |||||| |  : |||||||||
ttTCCATACATCGTGGAAACACT
bta-miR-98 16.9689 -17.36 3.913830e-02 3.838230e-02 6.160300e-06 177 198
UUGUUAUGUUGAAUGAUGGAGu
||:|||::||  ||:|||||:
AATAATGTAAAATATTACCTTc
bta-miR-199a-5p 16.7581 -20.24 3.413860e-02 3.356250e-02 3.356250e-02 270 291
uUGUCCAUCAGACUUGUGACCC
 |:|  | ||   |||||||||
cATACATCGTGGAAACACTGGG
mmu-miR-466f-3p 16.7347 -8.41 4.301860e-02 4.253460e-03 4.253460e-03 296 316
cacACAUACACACACACAUAc
   | ||| ||  |||||||
agaTATATATGACTGTGTATa
bta-let-7i 16.6527 -14.44 5.655670e-02 5.655670e-02 2.303480e-06 177 198
UUGUCGUGUUUGAUGAUGGAGu
||:| :::||| ||:|||||:
AATAATGTAAAATATTACCTTc
hsa-miR-769-5p 16.5473 -14.58 5.093370e-02 4.965830e-02 9.864950e-05 447 468
uCGAGUCUUGGGUCUCCAGAGU
 ||| | ||: :| ||||||::
tGCTAAAAATGTATAGGTCTTG
bta-let-7d 16.4419 -16.9 6.499790e-02 6.499790e-02 2.303480e-06 177 198
UUGAUACGUUGGAUGAUGGAGa
||: |||:||  ||:|||||:
AATAATGTAAAATATTACCTTc
hsa-miR-433 16.4419 -13.91 3.303330e-02 3.249370e-02 6.071230e-05 230 251
uGUGGCUCCUCGGGUAGUACUA
 || : |  ||  :||||||||
tCAATAAAAAGAATATCATGAT
hsa-miR-544 16.3365 -11.62 8.265320e-02 7.932960e-02 7.812250e-04 78 98
cuUGAACGAUUUUUACGUCUUa
  |||| | || ||||:||||
atACTTTC-AATAATGTAGAAa
hsa-miR-146b-3p 16.1257 -22.46 8.231520e-02 7.901840e-02 3.916380e-05 347 366
GGUCUUGACUCAGGUGUCCCGu
|:|||:|  ||   |||||||
CTAGAGCAAAG--AACAGGGCt
bta-let-7g 16.1257 -13.52 8.735250e-02 8.735250e-02 2.303480e-06 177 198
UUGACAUGUUUGAUGAUGGAGu
||:  |::||| ||:|||||:
AATAATGTAAAATATTACCTTc
bta-let-7f 16.1257 -13.85 8.653820e-02 8.653820e-02 2.303480e-06 177 198
UUGAUAUGUUAGAUGAUGGAGu
||: ||::||  ||:|||||:
AATAATGTAAAATATTACCTTc
bta-let-7c 16.1257 -14.73 9.884180e-02 9.411400e-02 2.303480e-06 177 198
UUGGUAUGUUGGAUGAUGGAGu
||: ||::||  ||:|||||:
AATAATGTAAAATATTACCTTc
bta-let-7a 16.1257 -14.83 9.379060e-02 9.379060e-02 2.303480e-06 177 198
UUGAUAUGUUGGAUGAUGGAGu
||: ||::||  ||:|||||:
AATAATGTAAAATATTACCTTc
mmu-miR-466b-5p 16.0203 -16.8 9.519460e-02 4.253460e-03 4.253460e-03 257 277
guaCAUGUACAUGUGUGUGUAG
   |||:|| | | ||:|||||
ttaGTATATTTTC-CATACATC
mmu-miR-466e-5p 16.0203 -16.8 9.506650e-02 4.253460e-03 4.253460e-03 257 277
auaCAUGUACAUGUGUGUGUAG
   |||:|| | | ||:|||||
ttaGTATATTTTC-CATACATC
mmu-miR-471 15.9149 -13.88 3.386590e-02 3.329890e-02 3.329890e-02 457 478
CACUUUUCGUGAUAUGAUGCAU
||  |:: | : :|||||:|||
GTATAGGTCTTGGTACTATGTA
bta-miR-21 15.8747 -14.06 6.197900e-02 6.009740e-02 1.069670e-02 471 493
UCAGUUGUAGUCAGACUAUUCGAU
| |  ::| || |:|||||||:|:
ACTATGTACCA-TTTGATAAGTTG
hsa-miR-338-5p 15.8095 -17.38 7.761440e-02 7.467880e-02 5.576930e-03 248 269
GUGAGUCGUGGUCCUAUAACAa
:: ||||||::|| ||||| |
TGATCAGCATTAGTATATTTTc
bta-miR-218 15.5696 -10.39 9.835460e-02 9.367250e-02 1.389410e-03 144 164
UGUACCAAUCUAGUUCGUGUU
| ||  | : || |||||:||
AAATTCTGGCATAAAGCATAA
bta-miR-450 15.1771 -15.57 9.305070e-02 8.885270e-02 1.364980e-03 262 283
UAUAAUCCUUGUGUAGCGUUUU
|||||    |:||||||:::||
ATATTTTCCATACATCGTGGAA
Features
AFFY_Bovine Bt.24699.1.S1_at
EMBL AY965877
EntrezGene 515909
GO GO:0003887
GO GO:0005622
GO GO:0006281
protein_id AAY46031
RefSeq_dna NM_001024692
RefSeq_peptide NP_001019863
UniGene Bt.24784
Uniprot/SPTREMBL Q4VE16
spacer
spacer