spacer

Target Detailed View


Hit information for ENSBTAT00000011066

Gene Name MYC_BOVIN
Transcript ENSBTAT00000011066
Gene ENSBTAG00000008409
Description Myc proto-oncogene protein (c-Myc) (Transcription factor p64). [Source:Uniprot/SWISSPROT;Acc:Q2HJ27]
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
cfa-miR-448 20.0358 -23.26 2.723970e-03 2.720260e-03 2.720260e-03 99 120
uaCCCUGUAGGAUGUAUACGUu
  || |||||:| ||||||||
taGGAACATCTTTCATATGCAt
bta-let-7c 19.1502 -26.22 4.884250e-03 4.884250e-03 7.345670e-08 166 187
UUGGUAUGUUGGAUGAUGGAGU
|:|||||| |:  |||:|||||
AGCCATACTATAAACTGCCTCA
bta-let-7b 18.8181 -26.19 7.425670e-03 7.425670e-03 7.345670e-08 166 187
UUGGUGUGUUGGAUGAUGGAGU
|:|||:|| |:  |||:|||||
AGCCATACTATAAACTGCCTCA
bta-let-7f 18.5967 -19.54 7.388580e-03 7.388580e-03 7.345670e-08 166 187
UUGAUAUGUUAGAUGAUGGAGU
|:| |||| ||  |||:|||||
AGCCATACTATAAACTGCCTCA
hsa-miR-672 18.2854 -21.49 1.111470e-02 1.105320e-02 6.764610e-05 111 131
AGUGUGUGUCAUGUGGUUGGAGU
|||:|::|| |: | ||||||||
TCATATGCA-TG-AACAACCTCA
bta-miR-98 18.2647 -18.15 1.071870e-02 1.066150e-02 1.334750e-04 166 187
UUGUUAUGUUGAAUGAUGGAGU
|:| |||| |:  |||:|||||
AGCCATACTATAAACTGCCTCA
bta-let-7a 18.2647 -19.23 1.130400e-02 1.130400e-02 7.345670e-08 166 187
UUGAUAUGUUGGAUGAUGGAGU
|:| |||| |:  |||:|||||
AGCCATACTATAAACTGCCTCA
mmu-miR-741 17.8448 -23.46 1.692380e-02 1.678140e-02 1.552270e-03 93 113
aGAUGUAUCUUACCGUAGAGAGU
 :|||||||:|   |||||:|||
cTTACATAGGA--ACATCTTTCA
hsa-miR-520d-5p 17.7882 -14.34 1.984040e-02 1.964490e-02 1.964490e-02 285 304
cuuucccGAAGGGAAACAUc
       :||:||||||||
cacccaaTTTTCCTTTGTAa
bta-miR-145 17.7346 -23.96 1.818240e-02 1.801810e-02 1.437920e-04 5 28
ucccUAAGGACCCU-UUUGACCUG
    |||   |||| :||||||||
acctATTGGAGGGAGGAACTGGAC
hsa-miR-524-5p 17.6005 -14.34 2.663660e-02 2.628500e-02 2.628500e-02 283 304
cucuuucacGAAGGGAAACAUc
         :||:||||||||
ttcacccaaTTTTCCTTTGTAa
hsa-miR-590-3p 17.2465 -6.63 7.222670e-02 6.968000e-02 1.476840e-02 323 341
UGAUCGAAUAUGUAUUUUAAu
| || ||| || ||||||||
AATAACTT-TA-ATAAAATTt
hsa-miR-802 17.0737 -13.61 3.165230e-02 3.115660e-02 1.516630e-02 33 56
uGUUCCUACUUAG-AAACAAUGAc
 ||:| |    || |||||||||
tCAGGAAATTCTCATTTGTTACTa
hsa-miR-526b 16.9635 -21.53 3.843540e-02 3.770610e-02 3.770610e-02 16 39
ugUCUUUCA-CGAAGGGAGUUCUc
  ||:|| | |  |||||||:||
ggAGGAACTGGACTCCCTCAGGAa
bta-let-7e 16.9127 -17.67 4.877560e-02 4.877560e-02 7.345670e-08 167 187
UGAUAUGUUGGAGGAUGGAGU
:| |||| |:   ||:|||||
GCCATACTATAAACTGCCTCA
bta-let-7g 16.8256 -16.37 4.369490e-02 4.369490e-02 7.345670e-08 166 187
UUGACAUGUUUGAUGAUGGAGU
|:|  ||| |   |||:|||||
AGCCATACTATAAACTGCCTCA
bta-let-7d 16.8256 -13.32 4.455120e-02 4.455120e-02 7.345670e-08 166 187
UUGAUACGUUGGAUGAUGGAGa
|:| || | |:  |||:||||
AGCCATACTATAAACTGCCTCa
hsa-miR-656 16.8014 -7.37 4.716360e-02 4.606870e-02 4.606870e-02 347 367
UCUCCAACUGACAUAUUAUAa
||:  ||  :  ||||||||
AGGTATTCCTACTATAATATa
mmu-miR-344 16.5229 -18.54 1.926080e-02 1.907650e-02 1.907650e-02 126 148
ugucaguccGAAACCGAUCUAGu
         | ||||||:||||
acctcacaaCCTTGGCTGGATCt
hsa-miR-196a 16.4935 -16.15 5.472660e-02 5.325600e-02 2.042350e-08 166 186
ggGUUGUUGUACUUUGAUGGAu
  | |:| :|| |||||:|||
agCCATACTAT-AAACTGCCTc
bta-let-7i 16.4935 -19.93 6.621240e-02 6.406800e-02 7.345670e-08 166 187
UUGUCGUGUUUGAUGAUGGAGU
|:|  :|| |   |||:|||||
AGCCATACTATAAACTGCCTCA
hsa-miR-382 16.4935 -13.26 6.079080e-02 5.897990e-02 4.996730e-03 310 331
gcuUAGGUGGUGCUUGUUGAAG
   ||: | ::: ||:|||||:
gccATTAAATGTAAATAACTTT
hsa-miR-491-5p 16.3828 -16.72 6.065580e-02 5.885290e-02 4.600700e-03 338 359
gGAGUACCUUCCCAAGGGGUGA
 :|:|| | |||  |:||:|||
aTTTATAGTAGGTATTCCTACT
mml-miR-189 16.1925 -16.58 3.703660e-02 3.635910e-02 3.635910e-02 329 352
uGACUAUAGUCGA-GUCAUCCGUG
 :| |||  | :| :||||||:|:
tTTAATAAAATTTATAGTAGGTAT
mmu-miR-683 16.0226 -15.47 8.274030e-02 7.940980e-02 9.495740e-03 329 349
cuccUGUGUCGAAUGUCGUCC
    |:| | :|||:||:|||
tttaATAAAATTTATAGTAGG
hsa-miR-644 15.978 -19.66 7.492970e-02 7.219130e-02 3.186830e-02 154 174
cGAGAUUCU--UUCGGUGUGA
 ||  ||||   |||||:|||
aCTGAAAGATTTAGCCATACT
hsa-miR-219-1-3p 15.7187 -12.4 8.940660e-02 4.609890e-03 4.609890e-03 171 192
gcccugcagGUCUGAGUUGAGA
         | | |||||||:|
tactataaaCTGCCTCAACTTT
hsa-miR-219-1-3p 15.608 -13.48 9.923530e-02 4.609890e-03 4.609890e-03 72 93
gccCUGCAGGUCUGAGUUGAGa
   |::  ||    |||||||
aaaGGTTCCCTCTGTCAACTCc
hsa-miR-517b 15.2759 -14.42 6.358560e-02 6.358560e-02 2.713420e-03 103 122
UUGUGAGAUUUCCCUACGUGCU
||||: :|  |   |||||:||
AACATCTTTCA--TATGCATGA
hsa-miR-935 15.2011 -21.17 8.419710e-02 8.074990e-02 4.768790e-03 4 26
cgccAUCGCCUUCGCCAUUGACC
    || :|||:|  | ||||||
gaccTATTGGAGGGAGGAACTGG
bta-miR-380-5p 14.8331 -11.89 9.982410e-02 9.500340e-02 9.051690e-04 70 92
cgcgUACAAGAUA-CCAGUUGGu
    | ||||  |  ||||||:
aaaaAGGTTCCCTCTGTCAACTc
hsa-miR-517c 14.7224 -13.42 9.482680e-02 9.046950e-02 2.713420e-03 102 123
ugugagauuuuccUACGUGCUa
             |||||:||
gaacatctttcatATGCATGAa
hsa-miR-517a 14.7224 -13.42 8.287620e-02 8.287620e-02 2.713420e-03 102 123
ugugagauuucccUACGUGCUa
             |||||:||
gaacatctttcatATGCATGAa
Features
AFFY_Bovine Bt.21164.1.S1_at
EMBL AF519455
EMBL BC113343
EntrezGene 511077
GO GO:0001836
GO GO:0003677
GO GO:0003700
GO GO:0005515
GO GO:0005634
GO GO:0005819
GO GO:0006309
GO GO:0006350
GO GO:0006355
GO GO:0006919
GO GO:0008284
GO GO:0008629
GO GO:0008633
GO GO:0008634
GO GO:0009314
GO GO:0016604
GO GO:0030528
GO GO:0042981
GO GO:0045449
protein_id AAI13344
protein_id AAN03880
RefSeq_dna NM_001046074
RefSeq_peptide NP_001039539
UniGene Bt.21164
Uniprot/SPTREMBL Q8MJ66
Uniprot/SWISSPROT Q2HJ27
spacer
spacer