spacer

Target Detailed View


Hit information for ENSBTAT00000010703

Gene Name LOC535490
Transcript ENSBTAT00000010703
Gene ENSBTAG00000008142
Description
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
hsa-miR-590-3p 18.1109 -8.27 4.029290e-02 3.949190e-02 1.408600e-03 294 315
UGA-UCGAAUAUGUAUUUUAAU
||| | :||  : |||||||||
ACTAAATTTCAGAATAAAATTA
hsa-miR-655 17.2278 -8.67 3.304740e-02 3.250730e-02 8.639890e-03 103 124
uuUCUCCAAUUGGUACAUAAUa
  || | || ||: ||||||:
tcAGTGCTTTACTCTGTATTGa
hsa-miR-518c 17.142 -14.59 1.354350e-02 1.354350e-02 1.354350e-02 90 113
UGUGA-GAUUUCUCUUCGCGAAAc
|||:|  |||| :  ||:|||||
ACATTAATAAAAGTCAGTGCTTTa
hsa-miR-542-3p 17.1152 -15.35 2.504590e-02 2.473490e-02 1.865500e-04 274 296
aaagucaAUAGUUA-GACAGUGu
       | |||:| |||||||
gtactaaTCTCAGTCCTGTCACt
hsa-miR-758 17.1152 -26.78 1.830060e-02 1.813420e-02 1.173220e-03 169 191
cCAAUCACCUG-GUCCAGUGUUU
 |||:||||:|  |||||| |||
tGTTGGTGGGCAGAGGTCAAAAA
hsa-miR-518a-3p 17.1152 -11.64 1.159800e-02 1.159800e-02 1.159800e-02 92 113
aGGUCGUUUCCCUUCGCGAAAg
 ::| :||| |  ||:|||||
aTTAATAAAAGTCAGTGCTTTa
hsa-miR-518b 17.1152 -10.65 9.239470e-03 9.239470e-03 9.239470e-03 92 113
UGGAGAUUUCCCCUCGCGAAAc
|::  |||| |  ||:|||||
ATTAATAAAAGTCAGTGCTTTa
hsa-miR-570 17.1152 -7.87 5.037430e-02 4.912660e-02 2.413420e-03 46 67
cguUUCCAUUAACGACAAAAGc
   | | |  || :|||||||
tacATGATTTTTATTGTTTTCa
mmu-miR-883b-5p 16.7774 -14.19 4.635210e-02 4.635210e-02 6.083080e-03 267 288
acugacgaugGGUAAGAGUCAu
          |:| |||||||
atctaaggtaCTAATCTCAGTc
hsa-miR-624 16.7525 -10.76 3.730270e-02 3.661550e-02 3.586010e-03 152 172
uccauuaUGGUUAUGGAACAc
       |::  ||||||||
gctttcaATTTCTACCTTGTt
bta-let-7i 16.6648 -11.49 5.587980e-02 5.587980e-02 1.164270e-06 149 170
uUGUCGUGUUUGAUGAUGGAGU
 |:: : : ||:| ||||||::
tATGCTTTCAATTTCTACCTTG
bta-miR-98 16.5522 -14.23 5.901840e-02 5.731060e-02 1.614930e-05 150 170
uuguuAUGUUGAAUGAUGGAGU
     | |||:|| ||||||::
atgctTTCAATTT-CTACCTTG
bta-let-7f 16.5522 -16 5.707910e-02 5.707910e-02 1.164270e-06 150 170
uugauAUGUUAGAUGAUGGAGU
     | ||||:| ||||||::
atgctTTCAATTT-CTACCTTG
hsa-miR-518d-3p 16.5262 -10.55 1.919370e-02 1.919370e-02 1.919370e-02 93 113
cgagGUUUCCCUUCGCGAAAc
    :||| |  ||:|||||
ttaaTAAAAGTCAGTGCTTTa
hsa-miR-518f 16.5262 -12.49 2.316170e-02 2.316170e-02 2.316170e-02 93 113
ggagAUUUCUCUUCGCGAAAg
    |||| :  ||:|||||
ttaaTAAAAGTCAGTGCTTTa
bta-let-7g 16.4396 -11.55 6.415550e-02 6.415550e-02 1.164270e-06 149 170
uUGACAUGUUUGAUGAUGGAGU
 |:  | : ||:| ||||||::
tATGCTTTCAATTTCTACCTTG
hsa-miR-524-5p 16.4396 -16.2 6.624070e-02 3.402940e-03 3.402940e-03 100 121
cUCUUUCACGAAGGGAAACAUc
 ||  |||||||: || ||||
aAGTCAGTGCTTTACTCTGTAt
bta-let-7c 16.4396 -14.86 7.298230e-02 7.298230e-02 1.164270e-06 150 170
uugGUAUGUUGGAUGAUGGAGU
   | | |||::| ||||||::
atgCTTTCAATTT-CTACCTTG
bta-let-7e 16.413 -17.28 7.834040e-02 7.834040e-02 1.164270e-06 147 170
UGAUAUG---UUGGAGGAUGGAGU
|:|||:|    | :|:||||||::
ATTATGCTTTCAATTTCTACCTTG
hsa-miR-520b 16.413 -10.05 5.699980e-02 1.507960e-04 6.631390e-05 92 112
gggagAUUUUCCUUCGUGAAA
     ||||||  ||::||||
attaaTAAAAGTCAGTGCTTT
mml-miR-189 16.3577 -14.54 3.198490e-02 3.147880e-02 3.147880e-02 159 181
UGACUAUAGUCGAGUCAUCCGUg
|:|  || |   |::||:||||
ATTTCTACCTTGTTGGTGGGCAg
hsa-miR-520c-3p 16.327 -10.11 6.328300e-02 1.507960e-04 6.631390e-05 91 112
ugggagAUUUUCCUUCGUGAAA
      ||||||  ||::||||
cattaaTAAAAGTCAGTGCTTT
mmu-miR-883a-5p 16.2144 -15.43 7.555510e-02 7.277140e-02 6.083080e-03 267 288
cauugaCGAUGAAGAGAGUCGu
      | ||||  ||||||:
atctaaGGTACTAATCTCAGTc
bta-let-7a 16.2144 -15.83 8.611440e-02 8.251070e-02 1.164270e-06 150 170
uugauAUGUUGGAUGAUGGAGU
     | |||::| ||||||::
atgctTTCAATTT-CTACCTTG
mmu-miR-467e 16.2144 -7.69 7.879450e-02 7.577020e-02 5.741120e-03 27 48
UGUAUAUGUACGAGUGUGAAUa
|:||   ||  :| |||:|||
ATATTATCAACTTGACATTTAc
hsa-miR-518e 16.1866 -11.42 2.678710e-02 2.643150e-02 2.643150e-02 91 112
GUGA-GACUUCCCUUCGCGAAA
||:|  | || |  ||:|||||
CATTAATAAAAGTCAGTGCTTT
hsa-miR-520a-5p 16.1866 -16.9 9.744160e-02 1.507960e-04 6.631390e-05 101 121
UCUUUCAUGAAGGGAGACCUc
||  |||:|||: ||||| |
AGTCAGTGCTTTACTCTGTAt
hsa-miR-767-3p 16.1336 -17.94 6.801520e-02 6.575370e-02 8.354180e-03 161 182
ucuuUGGUACCCCAUACUCGUCU
    ||| ||  | :||:|||||
ttctACCTTGTTG-GTGGGCAGA
hsa-miR-553 16.0734 -11.45 5.659480e-02 5.502310e-02 5.971180e-03 44 65
uuuUGU-UUUAGAGUGGCAAAA
   ||| :| |:|:|::|||||
tttACATGATTTTTATTGTTTT
mmu-miR-713 16.0286 -10.46 5.526040e-02 5.376130e-02 2.890280e-03 92 110
cgacacacggaAGUCACGu
           |||||||
attaataaaagTCAGTGCt
bta-miR-200b 15.9602 -8.32 7.304920e-02 3.684330e-03 1.436300e-04 213 233
GUAGUAAUGGUCCGUCAUAau
| |:| |:: : |||||||
CTTTAGTGTGGAGCAGTATat
hsa-miR-520f 15.8766 -20.9 9.753300e-02 1.507960e-04 6.631390e-05 209 230
UUGGGAGAUUUUCCUUCGUGAa
||||||:||: : |:|||| |
AACCCTTTAGTGTGGAGCAGTa
hsa-miR-520e 15.847 -8.66 9.914050e-02 1.507960e-04 6.631390e-05 92 112
gggaguUUUUCCUUCGUGAAA
      |||||  ||::||||
attaatAAAAGTCAGTGCTTT
bta-miR-200c 15.7975 -11.09 8.665830e-02 3.684330e-03 1.436300e-04 211 233
aGGUAGUAAUGGGCCGUCAUAau
 || |:| |::   |||||||
cCCTTTAGTGTGGAGCAGTATat
hsa-miR-509-3p 15.764 -13.71 6.408280e-02 6.207270e-02 3.849200e-05 262 283
gaugggugucUGCAUGGUUAGu
          | ||||:||||
taaggatctaAGGTACTAATCt
hsa-miR-801 15.7225 -15.88 6.022220e-02 5.844470e-02 5.867580e-03 207 230
cagcuaaggcgUGCGUCUCGUUAg
           ::|::|||||:|
aaaaccctttaGTGTGGAGCAGTa
bta-miR-200a 15.6855 -13.08 8.839830e-02 3.684330e-03 1.436300e-04 89 111
UUGUAGCAAUGGUCUGUCACAAu
|||||:  ||  || ||||| |
AACATTAATAAAAGTCAGTGCTt
hsa-miR-338-5p 15.6514 -9.49 8.754590e-02 8.382320e-02 7.026330e-03 216 237
GUGAGUCGUGGUCCUAUAACaa
:| |  | | ||| ||||||
TAGTGTGGAGCAGTATATTGcc
hsa-miR-525-3p 15.4262 -11.2 6.080990e-02 5.899790e-02 8.887180e-03 92 113
gcgagAUUUCCCUUCGCGGAAg
     |||| |  ||:||:||
attaaTAAAAGTCAGTGCTTTa
hsa-miR-524-3p 15.1678 -11.1 8.485600e-02 3.402940e-03 3.402940e-03 93 113
ugagGUUUCCCUUCGCGGAAg
    :||| |  ||:||:||
ttaaTAAAAGTCAGTGCTTTa
bta-miR-365 14.638 -8.9 9.034770e-02 8.638650e-02 7.338380e-04 231 252
uauuccuaaaaaUCCCCGUAAu
            | |||:|||
tattgccgtgggAAGGGTATTc
Features
AFFY_Bovine Bt.16857.1.A1_at
AFFY_Bovine Bt.24098.1.A1_at
EntrezGene 535490
RefSeq_dna_predicted XM_615590
RefSeq_peptide_predicted XP_615590
UniGene Bt.24098
UniGene Bt.79631
UniGene Bt.83124
spacer
spacer