spacer

Target Detailed View


Hit information for ENSBTAT00000008875

Gene Name LOC512977
Transcript ENSBTAT00000008875
Gene ENSBTAG00000006743
Description
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
mmu-miR-669c 18.8961 -25.27 7.848630e-03 7.817910e-03 2.455560e-03 144 166
uGUGUGUAG-GUGUGUGUUGAUA
 :|| |||| |||| ||||||||
tTACTCATCACACAGACAACTAT
hsa-miR-515-5p 18.7241 -20.13 7.913420e-03 7.882190e-03 7.882190e-03 486 510
gucUUUCACGA-AAGAAAACCUCUU
   :|||| || |||| ||||||||
cttGAAGTACTGTTCTGTTGGAGAA
mmu-miR-882 17.4182 -23.56 4.188580e-02 4.102070e-02 8.817870e-04 316 337
uGAUUACGCGAUUGAGAGAGGA
 ||:|| :|:|  ||||||:||
tCTGATTTGTTTCCTCTCTTCT
bta-miR-151 17.3981 -22.32 1.405060e-02 1.395240e-02 1.395240e-02 565 585
gGAGUUCCUCGAAGUCAGAUc
 | ::: |:||| |||||||
gCCTGGTGGGCTGCAGTCTAt
hsa-miR-518a-5p 17.2753 -20.97 2.741510e-02 2.484000e-03 5.731460e-06 223 243
cUUUCCCGAAGG-GAAACGUc
 ||:||||||:: :||||||
cAAGGGGCTTTTATTTTGCAc
hsa-miR-548a-5p 17.2071 -11.89 6.403970e-02 6.403970e-02 9.013200e-05 249 271
ccAUUUUGAGC-GUUAAUGAAAa
  |||:| |:| : ||||||||
atTAAGAGTTGTTCATTACTTTa
hsa-miR-130b 17.2071 -16.07 2.595470e-02 2.595470e-02 4.074920e-05 225 245
UACGGGAAAGUAGUAACGUGAc
| |  ||||:||: |||||||
AGGGGCTTTTATT-TTGCACTc
hsa-miR-548c-5p 17.1015 -14.21 6.846860e-02 6.846860e-02 9.013200e-05 249 271
ccGUUUUUGGC-GUUAAUGAAAa
  :||:|:::| : ||||||||
atTAAGAGTTGTTCATTACTTTa
hsa-miR-616 17.1015 -18.28 2.885100e-02 2.843880e-02 2.843880e-02 358 379
GACGAGUUUGGGAGGUUACUGA
|| :||| |::|  ||:|||||
CTCTTCACATTCAGCAGTGACT
hsa-miR-298 17.0504 -20.76 4.974870e-02 4.853150e-02 9.556290e-03 187 210
acccuCUUGGAGGGACGAAGACGa
     | |::|:|:|||||:|||
atgttGTATTTTCTTGCTTTTGCa
hsa-miR-335 17.0216 -12.35 2.396790e-02 2.368300e-02 2.368300e-02 187 209
UGUAAAAAGCAAUAACGAGAACu
|::|| | : || |||||:|||
ATGTTGTATTTTCTTGCTTTTGc
bta-miR-31 16.9737 -22.64 4.445060e-02 4.347710e-02 6.981660e-03 521 542
ucgauacGGUCGU-AGAACGGA
       ||||:| ||||||||
actcactCCAGTATTCTTGCCT
bta-miR-142 16.9554 -11.59 5.173900e-02 5.042330e-02 1.781270e-03 254 273
CAUCACGAAAGAUGAAAUAc
| : ||:|  :||||||||
GAGTTGTTCATTACTTTATt
bta-miR-19b 16.9165 -9.4 3.128630e-02 3.128630e-02 2.168140e-06 190 212
AGUCAAAACGUACCUAAACGUGu
|::  ||| | ||  |||||||
TTGTATTTTCTTGCTTTTGCACc
hsa-miR-548d-5p 16.7848 -9.87 9.794670e-02 9.330280e-02 9.013200e-05 249 271
ccGUUUUUGGU-GUUAAUGAAAa
  :||:|:::: : ||||||||
atTAAGAGTTGTTCATTACTTTa
hsa-miR-130a 16.6792 -14.07 3.941860e-02 3.865180e-02 4.074920e-05 225 245
UACGGGAAAAUUGUAACGUGAc
| |  ||||| |: |||||||
AGGGGCTTTT-ATTTTGCACTc
hsa-miR-575 16.6197 -25.91 4.063090e-02 3.981650e-02 3.981650e-02 87 104
cGAGGACAGGUUGACCGAG
 |||||||  ||||||:|:
tCTCCTGT-AAACTGGTTT
bta-miR-19a 16.6013 -9.4 4.652940e-02 4.546350e-02 2.168140e-06 190 212
AGUCAAAACGUAUCUAAACGUGu
|::  ||| | |:  |||||||
TTGTATTTTCTTGCTTTTGCACc
hsa-miR-520f 16.5737 -12.59 5.069110e-02 4.942770e-02 8.117510e-03 476 497
UUGGGAGAUUUUCCUUCGUGAa
|||::|: ||   ||||:|||
AACTTTTCAACTTGAAGTACTg
mmu-miR-721 16.4433 -13.67 4.466230e-02 4.367960e-02 1.056160e-04 224 245
aaggggGAAAAU-UAACGUGAc
      ||||||  |||||||
aaggggCTTTTATTTTGCACTc
hsa-miR-596 16.125 -23.17 8.072330e-02 7.755110e-02 8.021660e-03 557 577
gGGCUCCUCGGCCCGUCCGAa
 | || ||||| ||::||||
aCAGAAGAGCCTGGTGGGCTg
bta-miR-101 16.0189 -12.19 5.656360e-02 5.499360e-02 1.149180e-02 479 499
aagucaauAGUGUCAUGACAu
        |:: ||||||||
ttttcaacTTGAAGTACTGTt
cfa-miR-429 15.9403 -15.7 8.139890e-02 7.817410e-02 3.007270e-03 515 536
UGCCGUAAUGGUCUGUCAUAAu
|:||||   |    |||||||
ATGGCAACTCACTCCAGTATTc
hsa-miR-936 15.9403 -12.31 9.252700e-02 8.837540e-02 2.808250e-03 103 124
GACGCUAAGGAGGGAGAUGACa
:| : | || |:::||||:||
TTATAAATCATTTTTCTATTGa
hsa-miR-410 15.8068 -11.6 6.639130e-02 6.423540e-02 1.295240e-02 176 196
uguccggUAGACACAAUAUAA
       :|:| ||||:||||
tggataaGTTTATGTTGTATT
hsa-miR-590-5p 15.7291 -13.36 7.102690e-02 6.856320e-02 9.915250e-06 165 186
gacgugaaaAUACUUAUUCGAG
         |:||:|||||:|:
atttaaaaaTGTGGATAAGTTT
bta-miR-18a 15.6236 -16.62 9.023640e-02 8.628480e-02 2.158720e-03 196 215
AUAGACGUGAUCUACGUGGAAU
| ||| ::||   ||||||||:
TTTCT-TGCT-TTTGCACCTTG
bta-miR-10a 15.5506 -19.55 7.125850e-02 7.125850e-02 9.897250e-03 569 591
gUGUUUAAGCCUAGAUGUCCCAu
 ::::: |   :||||:|||||
gGTGGGCTGCAGTCTATAGGGTt
hsa-miR-153 15.3069 -10.25 9.450450e-02 9.017640e-02 9.936330e-03 396 416
CUAGUGAAAACACUGAUACGUU
|||: :| || |  |||||:|:
GATTTTTATTCT-CCTATGTAG
hsa-miR-518f 15.2763 -15.78 7.219560e-02 2.484000e-03 5.731460e-06 115 134
GGAGAUUUCUCUUCGCGAAAG
::||||  || |||:|:|||:
TTTCTATTGA-AAGTGTTTTT
bta-miR-10b 15.0253 -19.18 9.699420e-02 9.243870e-02 9.897250e-03 569 591
guguuuaagccaAGAUGUCCCAu
            ||||:|||||
ggtgggctgcagTCTATAGGGTt
Features
AFFY_Bovine Bt.27316.1.S1_at
AFFY_Bovine Bt.27316.2.A1_at
GO GO:0000082
GO GO:0001835
spacer
spacer