spacer

Target Detailed View


Hit information for ENSBTAT00000008409

Gene Name XR_027635.1
Transcript ENSBTAT00000008409
Gene ENSBTAG00000006413
Description PREDICTED: Bos taurus hypothetical protein LOC784488 (LOC784488), mRNA. [Source:RefSeq_dna;Acc:XR_027635]
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
hsa-miR-587 18.4036 -14.91 1.059060e-02 1.053470e-02 1.053470e-02 74 94
CACUGAGUAGUGGAUACCUUU
| ||  ::| | ||||||||:
GAGAACTGTGAACTATGGAAG
hsa-miR-382 17.5103 -23.82 2.346990e-02 2.319660e-02 1.105710e-02 183 204
gcUUAGGUGGUGCUUGUUGAAG
  :|||||  | ||:||:||||
aaGATCCAAAAGGAGCAGCTTC
bta-let-7a 17.2829 -19.03 3.016090e-02 3.016090e-02 2.238910e-06 146 168
uugaUAUGUUGGAU-GAUGGAGU
    ||:| ||| | ||||:|||
tgaaATGCTACCGATCTACTTCA
bta-let-7c 17.2829 -18.93 3.180090e-02 3.180090e-02 2.238910e-06 146 168
uuggUAUGUUGGAU-GAUGGAGU
    ||:| ||| | ||||:|||
tgaaATGCTACCGATCTACTTCA
mmu-miR-692 17.2605 -10.48 3.348200e-02 3.292770e-02 3.292770e-02 105 125
cucacuccGCGAGUUUCUCUa
        | :|:|||||||
cattttttCCTTTAAAGAGAa
bta-miR-27a 17.1274 -14.51 3.329130e-02 3.329130e-02 1.120250e-03 67 85
gccUUGAAUCGGUGACACUU
   | || ||  ||||||||
ctcATCTGAG-AACTGTGAA
bta-let-7d 17.0555 -18.38 3.546950e-02 3.546950e-02 2.238910e-06 146 168
uugaUACGUUGGAU-GAUGGAGa
    |||| ||| | ||||:||
tgaaATGCTACCGATCTACTTCa
hsa-miR-522 17.0555 -8.74 4.131040e-02 4.046880e-02 1.081590e-02 89 110
ugugagauuucccUUGGUAAAA
             |||||||||
tggaagaaatcaaAACCATTTT
hsa-miR-876-3p 17.0555 -14.18 2.690520e-02 2.762880e-03 2.762880e-03 124 144
acuuaAUGAAACAUUUGGUGGU
     ||: ||| |||||||:|
aaacgTATGTTG-AAACCACTA
bta-miR-27b 17.0319 -14.79 3.894350e-02 3.819500e-02 1.120250e-03 66 85
cgucUUGAAUCGGUGACACUU
    | || ||  ||||||||
tctcATCTGAG-AACTGTGAA
bta-let-7e 17.0319 -19.46 4.352190e-02 4.352190e-02 2.238910e-06 147 168
ugaUAUGUUGG-AGGAUGGAGU
   ||:| |||  :||||:|||
gaaATGCTACCGATCTACTTCA
bta-miR-98 16.9418 -15.03 4.020180e-02 3.940440e-02 7.609140e-05 146 168
uugUUAUGUUGAAU-GAUGGAGU
   |||:| ||  | ||||:|||
tgaAATGCTACCGATCTACTTCA
bta-let-7b 16.9418 -18.45 4.807510e-02 4.807510e-02 2.238910e-06 146 168
uuggUGUGUUGGAU-GAUGGAGU
    |::| ||| | ||||:|||
tgaaATGCTACCGATCTACTTCA
hsa-miR-582-5p 16.8566 -11.23 3.743490e-02 3.674290e-02 3.674290e-02 62 84
UCAUUGACCAACUUGUUGACAUU
| || ||  |  :| ||||||:|
AATATCTCATCTGAGAACTGTGA
hsa-miR-105 16.6303 -12.84 3.547490e-02 3.485300e-02 2.274590e-03 1 23
ugguguccucagacUCGUAAACU
              ||||||||:
aagacttcatctatAGCATTTGG
bta-let-7i 16.487 -12.26 6.664340e-02 6.664340e-02 2.238910e-06 149 168
UUGUCGUGUUUGAUGAUGGAGU
||:: :|| :|:  ||||:|||
AATGCTACCGAT--CTACTTCA
bta-let-7f 16.3733 -14.69 6.802090e-02 6.802090e-02 2.238910e-06 146 168
uugaUAUGUUAGAU-GAUGGAGU
    ||:| | | | ||||:|||
tgaaATGCTACCGATCTACTTCA
bta-let-7g 16.2596 -12.07 7.661530e-02 7.375390e-02 2.238910e-06 149 168
UUGACAUGUUUGAUGAUGGAGU
||:  ||| :|:  ||||:|||
AATGCTACCGAT--CTACTTCA
hsa-miR-509-3p 16.2596 -12.32 3.881160e-02 3.806810e-02 1.731180e-03 142 162
GAUGGGUGUCUGCAUGGUUAGu
||| : | | :| ||||:|||
CTAATGAAATGC-TACCGATCt
hsa-miR-876-5p 16.2596 -12.8 7.624270e-02 2.762880e-03 2.762880e-03 79 101
acCACUAAGUG-UUUCUUUAGgu
  ||||  :|: :||||||||
ctGTGAACTATGGAAGAAATCaa
hsa-miR-454 16.1778 -16.98 6.570520e-02 6.359310e-02 7.426310e-03 207 230
uGGGAUA-UUCGUUAUAACGUGAU
 :|| || |:|::| | |||||||
cTCCAATGAGGTGAAAGTGCACTA
hsa-miR-485-5p 16.1459 -13.74 9.900300e-02 9.426000e-02 2.517360e-03 184 205
cUUAAGUAGUGCCGGUCGGAGa
 :|| ||  | |  ||||:||
aGATCCAAAAGGAGCAGCTTCa
hsa-miR-409-3p 15.4636 -11.64 9.358530e-02 8.933970e-02 1.858760e-02 1 21
UCCCCAAGUGGCUCGUUGUAAG
| |  ||||:| | :|:||||:
AAGACTTCATCTA-TAGCATTT
mmu-miR-471 15.0088 -16.07 8.189470e-02 7.863100e-02 1.172640e-02 212 233
cACUUUUC-GUGAUAUGAUGCau
 |||:: |  | |: ||||||
aTGAGGTGAAAGTGCACTACGa-
Features
AFFY_Bovine Bt.27479.1.A1_at
EntrezGene 784488
EntrezGene 540295
GO GO:0005730
RefSeq_dna XR_027635
RefSeq_dna_predicted XM_592991
RefSeq_peptide_predicted XP_592991
UniGene Bt.55063
spacer
spacer